The c.337_354del (p.Phe113_Arg118del) variant in the GLA gene is an in-frame deletion of 18 bp that is predicted to shorten the encoded protein by 6 amino acids but does not introduce a frameshift. Also known as c.333del18, this variant is a known pathogenic variant associated with the classic Fabry phenotype (PMID: 7531540). It is absent from general population databases. We consider this variant is to be pathogenic.
ClinVar Genomic variation as it relates to human health
NM_000169.3(GLA):c.337_354del (p.Phe113_Arg118del)
Germline
Classification
Help
criteria provided, multiple submitters, no conflicts. Learn more about how ClinVar calculates review status.
Pathogenic
3 out of 3 submissions contributed to this classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
3
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000169.3(GLA):c.337_354del (p.Phe113_Arg118del)
Variation ID: 1180491 Accession: VCV001180491.4
- Type and length
-
Deletion, 18 bp
- Location
-
Cytogenetic: Xq22.1 X: 101403826-101403843 (GRCh38) [ NCBI UCSC ] X: 100658814-100658831 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jul 24, 2021 Sep 27, 2025 Sep 15, 2025 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000169.3:c.337_354del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000160.1:p.Phe113_Arg118del inframe deletion NM_000169.2:c.334_351del18 NP_000160.1:p.Phe113_Arg118del inframe indel NM_001199973.2:c.301-8107_301-8090del intron variant NM_001199974.2:c.178-8107_178-8090del intron variant NM_001406747.1:c.460_477del NP_001393676.1:p.Phe154_Arg159del inframe deletion NM_001406748.1:c.337_354del NP_001393677.1:p.Phe113_Arg118del inframe deletion NM_001406749.1:c.460_477del NP_001393678.1:p.Phe154_Arg159del inframe deletion NR_164783.1:n.359_376del non-coding transcript variant NR_176252.1:n.359_376del non-coding transcript variant NR_176253.1:n.359_376del non-coding transcript variant NC_000023.11:g.101403829_101403846del NC_000023.10:g.100658817_100658834del NG_007119.1:g.9121_9138del NG_016327.1:g.627_644del LRG_672:g.9121_9138del LRG_672t1:c.337_354del - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000023.11:101403825:GCGAATCCCATGAGGAAAGCG:GCG
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| GLA | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
6 | 2181 | |
| RPL36A-HNRNPH2 | - | - | - |
GRCh38 GRCh37 |
- | 2254 |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Sep 15, 2025 | RCV001537870.6 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
Expand all rows
Collapse all rows
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Nov 07, 2019)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Fabry disease |
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine
Accession: SCV001754804.1
First in ClinVar: Jul 24, 2021 Last updated: Jul 24, 2021 |
Comment:
show
The c.337_354del (p.Phe113_Arg118del) variant in the GLA gene is an in-frame deletion of 18 bp that is predicted to shorten the encoded protein by 6 amino acids but does not introduce a frameshift. Also known as c.333del18, this variant is a known pathogenic variant associated with the classic Fabry phenotype (PMID: 7531540). It is absent from general population databases. We consider this variant is to be pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Feb 25, 2023)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Fabry disease |
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV004299647.2
First in ClinVar: Feb 14, 2024 Last updated: Mar 04, 2025 |
Comment:
show
ClinVar contains an entry for this variant (Variation ID: 1180491). This variant has been observed in individuals with Fabry disease (PMID: 7531540; Invitae). This variant is not present in population databases (gnomAD no frequency). This variant, c.337_354del, results in the deletion of 6 amino acid(s) of the GLA protein (p.Phe113_Arg118del), but otherwise preserves the integrity of the reading frame. This variant disrupts a region of the GLA protein in which other variant(s) (p.Phe113Leu) have been determined to be pathogenic (PMID: 16773563, 17555407, 32099817). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
Observation: 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
Observation 1
Collection method: clinical testing
Allele origin: germline
Affected status: unknown
|
|
|
Pathogenic
(Sep 15, 2025)
C
Contributing to aggregate classification
|
criteria provided, single submitter
|
Fabry disease |
Genomenon, Inc, Genomenon, Inc
Accession: SCV006335463.1
First in ClinVar: Sep 27, 2025 Last updated: Sep 27, 2025 |
Comment:
show
GLA c.337_354del is an in-frame deletion variant that results in the deletion of multiple amino acids, from Phenylalanine at position 113 to Arginine at position 118. This variant has been observed in at least one proband affected with Fabry disease (PMID:7531540;10649504;34363016). At least one functional study has demonstrated a substantial alteration in protein function relative to the wild-type (PMID:27657681). It is absent or not present at a significant frequency in gnomAD. In conclusion, we classify GLA p.Phe113_Arg118del (c.337_354del) as a pathogenic variant. (less)
Observation: 1
Collection method: curation
Allele origin: germline
Affected status: yes
Observation 1
Collection method: curation
Allele origin: germline
Affected status: yes
|
|
Comment:
Comment:
ClinVar contains an entry for this variant (Variation ID: 1180491). This variant has been observed in individuals with Fabry disease (PMID: 7531540; Invitae). This variant is not present in population databases (gnomAD no frequency). This variant, c.337_354del, results in the deletion of 6 amino acid(s) of the GLA protein (p.Phe113_Arg118del), but otherwise preserves the integrity of the reading frame. This variant disrupts a region of the GLA protein in which other variant(s) (p.Phe113Leu) have been determined to be pathogenic (PMID: 16773563, 17555407, 32099817). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.
Comment:
GLA c.337_354del is an in-frame deletion variant that results in the deletion of multiple amino acids, from Phenylalanine at position 113 to Arginine at position 118. This variant has been observed in at least one proband affected with Fabry disease (PMID:7531540;10649504;34363016). At least one functional study has demonstrated a substantial alteration in protein function relative to the wild-type (PMID:27657681). It is absent or not present at a significant frequency in gnomAD. In conclusion, we classify GLA p.Phe113_Arg118del (c.337_354del) as a pathogenic variant.
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Genetic testing in ambulatory cardiology clinics reveals high rate of findings with clinical management implications. | Murdock DR | Genetics in medicine : official journal of the American College of Medical Genetics | 2021 | PMID: 34363016 |
| Natural history of the late-onset phenotype of Fabry disease due to the p.F113L mutation. | Azevedo O | Molecular genetics and metabolism reports | 2020 | PMID: 32099817 |
| The validation of pharmacogenetics for the identification of Fabry patients to be treated with migalastat. | Benjamin ER | Genetics in medicine : official journal of the American College of Medical Genetics | 2017 | PMID: 27657681 |
| Mutant alpha-galactosidase A enzymes identified in Fabry disease patients with residual enzyme activity: biochemical characterization and restoration of normal intracellular processing by 1-deoxygalactonojirimycin. | Ishii S | The Biochemical journal | 2007 | PMID: 17555407 |
| High incidence of later-onset fabry disease revealed by newborn screening. | Spada M | American journal of human genetics | 2006 | PMID: 16773563 |
| Five novel mutations in fourteen patients with Fabry Disease. | Rosenberg KM | Human mutation | 2000 | PMID: 10649504 |
| Fabry disease: twenty-three mutations including sense and antisense CpG alterations and identification of a deletional hot-spot in the alpha-galactosidase A gene. | Eng CM | Human molecular genetics | 1994 | PMID: 7531540 |
Text-mined citations for rs2147480442 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Jan 17, 2026
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.