Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001844.5(COL2A1):c.3270_3273delinsCAGCAAGGAGACAAGGAGACAGAG (p.Glu1090fs)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jun 14, 2021)
Last evaluated:
May 21, 2021
Accession:
VCV001172708.1
Variation ID:
1172708
Description:
24bp indel
Help

NM_001844.5(COL2A1):c.3270_3273delinsCAGCAAGGAGACAAGGAGACAGAG (p.Glu1090fs)

Allele ID
1161902
Variant type
Indel
Variant length
24 bp
Cytogenetic location
12q13.11
Genomic location
12: 47977320-47977323 (GRCh38) GRCh38 UCSC
12: 48371103-48371106 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NM_001844.5:c.3270_3273delAGCTinsCAGCAAGGAGACAAGGAGACAGAG MANE Select
NC_000012.11:g.48371103_48371106delinsCTCTGTCTCCTTGTCTCCTTGCTG
NC_000012.12:g.47977320_47977323delinsCTCTGTCTCCTTGTCTCCTTGCTG
... more HGVS
Protein change
E1021fs, E1090fs
Other names
-
Canonical SPDI
NC_000012.12:47977319:AGCT:CTCTGTCTCCTTGTCTCCTTGCTG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter May 21, 2021 RCV001526714.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
COL2A1 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
1214 1225

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter More information
Pathogenic
(May 21, 2021)
criteria provided, single submitter
Method: clinical testing
Stickler syndrome type 1
Affected status: yes
Allele origin: germline
DBGen Ocular Genomics
Accession: SCV001737137.1
Submitted: (Jun 14, 2021)
Number of individuals with the variant: 1
Sex: female
Geographic origin: Mexico

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Nov 27, 2021