Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_020631.6(PLEKHG5):c.2162_2163insTGAGCAGGAGGAGGAAGAGGAGGAGGAGGAGGAG (p.Glu721fs)

Help
Interpretation:
Likely benign​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 7, 2021)
Last evaluated:
Aug 5, 2020
Accession:
VCV001146824.1
Variation ID:
1146824
Description:
34bp insertion
Help

NM_020631.6(PLEKHG5):c.2162_2163insTGAGCAGGAGGAGGAAGAGGAGGAGGAGGAGGAG (p.Glu721fs)

Allele ID
1131675
Variant type
Insertion
Variant length
34 bp
Cytogenetic location
1p36.31
Genomic location
1: 6469128-6469129 (GRCh38) GRCh38 UCSC
1: 6529188-6529189 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000001.10:g.6529188_6529189insCTCCTCCTCCTCCTCCTCTTCCTCCTCCTGCTCA
NC_000001.11:g.6469128_6469129insCTCCTCCTCCTCCTCCTCTTCCTCCTCCTGCTCA
NM_020631.6:c.2162_2163insTGAGCAGGAGGAGGAAGAGGAGGAGGAGGAGGAG MANE Select NP_065682.2:p.Glu721fs frameshift
... more HGVS
Protein change
E721fs, E758fs, E790fs
Other names
-
Canonical SPDI
NC_000001.11:6469128::CTCCTCCTCCTCCTCCTCTTCCTCCTCCTGCTCA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely benign 1 criteria provided, single submitter Aug 5, 2020 RCV001486173.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
PLEKHG5 - - GRCh38
GRCh37
669 733

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Likely benign
(Aug 05, 2020)
criteria provided, single submitter
Method: clinical testing
Distal spinal muscular atrophy, autosomal recessive 4
Charcot-Marie-Tooth disease, recessive intermediate c
Allele origin: germline
Invitae
Accession: SCV001690627.1
Submitted: (Jan 07, 2021)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Jun 14, 2021