Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000284.4(PDHA1):c.1009-31_1009-7del

Help
Interpretation:
Likely benign​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 7, 2021)
Last evaluated:
Apr 26, 2020
Accession:
VCV001095690.1
Variation ID:
1095690
Description:
25bp deletion
Help

NM_000284.4(PDHA1):c.1009-31_1009-7del

Allele ID
1086516
Variant type
Deletion
Variant length
25 bp
Cytogenetic location
Xp22.12
Genomic location
X: 19359457-19359481 (GRCh38) GRCh38 UCSC
X: 19377575-19377599 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000023.10:g.19377576_19377600del
NC_000023.11:g.19359458_19359482del
NG_016781.1:g.20566_20590del
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000023.11:19359456:TAAAACCTTTTACACTGTTACCTAAT:T
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Likely benign 1 criteria provided, single submitter Apr 26, 2020 RCV001416698.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
PDHA1 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
325 531

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter More information
Likely benign
(Apr 26, 2020)
criteria provided, single submitter
Method: clinical testing
Pyruvate dehydrogenase E1-alpha deficiency
Affected status: unknown
Allele origin: germline
Invitae
Accession: SCV001618881.1
Submitted: (Jan 07, 2021)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Nov 27, 2021