Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000441.2(SLC26A4):c.412_415+17del

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Jan 7, 2021)
Last evaluated:
Aug 3, 2020
Accession:
VCV001069942.1
Variation ID:
1069942
Description:
21bp deletion
Help

NM_000441.2(SLC26A4):c.412_415+17del

Allele ID
1060945
Variant type
Deletion
Variant length
21 bp
Cytogenetic location
7q22.3
Genomic location
7: 107672245-107672265 (GRCh38) GRCh38 UCSC
7: 107312690-107312710 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000007.13:g.107312690_107312710del
NC_000007.14:g.107672245_107672265del
NM_000441.2:c.412_415+17del MANE Select splice donor
NG_008489.1:g.16611_16631del
Protein change
-
Other names
-
Canonical SPDI
NC_000007.14:107672244:GTTGGTAATTATAAGTATATT:
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Aug 3, 2020 RCV001381940.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
SLC26A4 - - GRCh38
GRCh37
749 825

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Aug 03, 2020)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
Invitae
Accession: SCV001580517.1
Submitted: (Jan 07, 2021)
Evidence details
Publications
PubMed (7)
Comment:
This variant results in the deletion of part of exon 4 (c.412_415+21delinsTGACA) of the SLC26A4 gene. It is expected to disrupt RNA splicing and likely … (more)

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
Characterising the spectrum of autosomal recessive hereditary hearing loss in Iran. Sloan-Heggen CM Journal of medical genetics 2015 PMID: 26445815
Mutation Spectrum of Common Deafness-Causing Genes in Patients with Non-Syndromic Deafness in the Xiamen Area, China. Jiang Y PloS one 2015 PMID: 26252218
Evaluation of genotype-phenotype relationships in patients referred for endocrine assessment in suspected Pendred syndrome. Soh LM European journal of endocrinology 2015 PMID: 25394566
Life-threatening metabolic alkalosis in Pendred syndrome. Kandasamy N European journal of endocrinology 2011 PMID: 21551164
Assessment of the genetic causes of recessive childhood non-syndromic deafness in the UK - implications for genetic testing. Hutchin T Clinical genetics 2005 PMID: 16283880
Mutations of the PDS gene, encoding pendrin, are associated with protein mislocalization and loss of iodide efflux: implications for thyroid dysfunction in Pendred syndrome. Taylor JP The Journal of clinical endocrinology and metabolism 2002 PMID: 11932316
Two frequent missense mutations in Pendred syndrome. Van Hauwe P Human molecular genetics 1998 PMID: 9618166

Record last updated May 13, 2021