NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs) AND Bohring-Opitz syndrome

Clinical significance:Pathogenic (Last evaluated: Mar 5, 2021)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV001706715.1

Allele description [Variation Report for NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)]

NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)

Gene:
ASXL1:ASXL transcriptional regulator 1 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
20q11.21
Genomic location:
Preferred name:
NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)
HGVS:
  • NC_000020.11:g.32434612_32434634del
  • NG_027868.1:g.81269_81291del
  • NM_001363734.1:c.1717_1739del
  • NM_015338.6:c.1900_1922delMANE SELECT
  • NP_001350663.1:p.Glu574fs
  • NP_056153.2:p.Glu635fs
  • LRG_630t1:c.1900_1922del
  • LRG_630:g.81269_81291del
  • NC_000020.10:g.31022415_31022437del
  • NM_015338.5:c.1900_1922delAGAGAGGCGGCCACCACTGCCAT
Protein change:
E574fs
Links:
dbSNP: rs766433101
NCBI 1000 Genomes Browser:
rs766433101
Molecular consequence:
  • NM_001363734.1:c.1717_1739del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_015338.6:c.1900_1922del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:
Bohring-Opitz syndrome
Synonyms:
C-like syndrome; Opitz trigonocephaly-like syndrome; Bohring syndrome; See all synonyms [MedGen]
Identifiers:
MONDO: MONDO:0011510; MedGen: C0796232; Orphanet: 97297; OMIM: 605039

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001934469Institute of Human Genetics, University of Leipzig Medical Centercriteria provided, single submitter
Pathogenic
(Mar 5, 2021)
de novoclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedde novoyesnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee..

Genet Med. 2015 May;17(5):405-24. doi: 10.1038/gim.2015.30. Epub 2015 Mar 5.

PubMed [citation]
PMID:
25741868
PMCID:
PMC4544753

Details of each submission

From Institute of Human Genetics, University of Leipzig Medical Center, SCV001934469.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

This variant was identified as de novo (maternity and paternity confirmed).

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1de novoyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Nov 20, 2021

Support Center