NM_000314.8(PTEN):c.802-51_802-14del AND not provided

Clinical significance:Benign (Last evaluated: Mar 28, 2018)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
2 submissions [Details]
Record status:
current
Accession:
RCV001668370.3

Allele description [Variation Report for NM_000314.8(PTEN):c.802-51_802-14del]

NM_000314.8(PTEN):c.802-51_802-14del

Gene:
PTEN:phosphatase and tensin homolog [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
10q23.31
Genomic location:
Preferred name:
NM_000314.8(PTEN):c.802-51_802-14del
HGVS:
  • NC_000010.11:g.87960843_87960880del
  • NG_007466.2:g.102405_102442del
  • NM_000314.8:c.802-51_802-14delMANE SELECT
  • NM_001304717.5:c.1322-51_1322-14del
  • NM_001304718.2:c.211-51_211-14del
  • LRG_311t1:c.802-51_802-14del
  • LRG_311:g.102405_102442del
  • NC_000010.10:g.89720598_89720635del
  • NC_000010.10:g.89720600_89720637del
  • NM_000314.4:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT
  • NM_000314.6:c.802-51_802-14del
  • NM_000314.6:c.802-51_802-14del38
  • NM_000314.6:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT
  • NM_000314.7(PTEN):c.802-51_802-14del
Links:
dbSNP: rs557364463
NCBI 1000 Genomes Browser:
rs557364463
Molecular consequence:
  • NM_000314.8:c.802-51_802-14del - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304717.5:c.1322-51_1322-14del - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304718.2:c.211-51_211-14del - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000729411GeneDxcriteria provided, single submitter
Benign
(Mar 28, 2018)
germlineclinical testing

Citation Link,

SCV001883777GeneDxcriteria provided, single submitter
Benign
(Mar 3, 2015)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From GeneDx, SCV000729411.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

From GeneDx, SCV001883777.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

This variant is associated with the following publications: (PMID: 11986403)

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Dec 2, 2021

Support Center