U.S. flag

An official website of the United States government

NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del) AND not provided

Germline classification:
Likely benign (1 submission)
Last evaluated:
Dec 9, 2020
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001571532.3

Allele description [Variation Report for NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del)]

NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del)

Gene:
KCNA5:potassium voltage-gated channel subfamily A member 5 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
12p13.32
Genomic location:
Preferred name:
NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del)
HGVS:
  • NC_000012.11:g.5153498_5153530del
  • NC_000012.12:g.5044360_5044392del
  • NG_012198.1:g.5442_5474del
  • NM_002234.4:c.213_245delMANE SELECT
  • NP_002225.2:p.Asp72_Pro82del
  • NC_000012.11:g.5153498_5153530del
  • NC_000012.11:g.5153526_5153558del
  • NC_000012.11:g.5153526_5153558delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC
  • NM_002234.2:c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC
  • NM_002234.3:c.213_245del
  • NM_002234.3:c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC
Links:
dbSNP: rs144879674
NCBI 1000 Genomes Browser:
rs144879674
Molecular consequence:
  • NM_002234.4:c.213_245del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: C3661900

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001796030GeneDx
criteria provided, single submitter

(GeneDx Variant Classification Process June 2021)
Likely benign
(Dec 9, 2020)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From GeneDx, SCV001796030.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

This variant is associated with the following publications: (PMID: 32577384, 20638934, 32397294)

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Mar 16, 2024