NM_001943.5(DSG2):c.1752_1784del (p.Gln584_Leu594del) AND not provided

Clinical significance:Uncertain significance (Last evaluated: Sep 13, 2019)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV001571015.3

Allele description [Variation Report for NM_001943.5(DSG2):c.1752_1784del (p.Gln584_Leu594del)]

NM_001943.5(DSG2):c.1752_1784del (p.Gln584_Leu594del)

Gene:
DSG2:desmoglein 2 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
18q12.1
Genomic location:
Preferred name:
NM_001943.5(DSG2):c.1752_1784del (p.Gln584_Leu594del)
HGVS:
  • NC_000018.10:g.31538851_31538883del
  • NG_007072.3:g.45610_45642del
  • NM_001943.5:c.1752_1784delMANE SELECT
  • NP_001934.2:p.Gln584_Leu594del
  • LRG_397t1:c.1752_1784del
  • LRG_397:g.45610_45642del
  • NC_000018.9:g.29118814_29118846del
  • NM_001943.3:c.1752_1784delGGTCCTTACACTCACAGTTTGTGAGTGTCTGCA
Links:
dbSNP: rs1333431543
NCBI 1000 Genomes Browser:
rs1333431543
Molecular consequence:
  • NM_001943.5:c.1752_1784del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001795406GeneDxcriteria provided, single submitter
Uncertain significance
(Sep 13, 2019)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From GeneDx, SCV001795406.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

Has not been previously published as pathogenic or benign to our knowledge; Not observed in large population cohorts (Lek et al., 2016); Reported in ClinVar as a variant of uncertain significance (ClinVar Variant ID# 579139; Landrum et al., 2016); In-frame deletion of 11 amino acids in a non-repeat region; In silico analysis, which includes protein predictors and evolutionary conservation, supports a deleterious effect

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2021

Support Center