NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup) AND not provided

Clinical significance:Pathogenic (Last evaluated: Jan 31, 2020)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV001386204.1

Allele description [Variation Report for NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)]

NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)

Gene:
AIP:aryl hydrocarbon receptor interacting protein [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
11q13.2
Genomic location:
Preferred name:
NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)
HGVS:
  • NC_000011.10:g.67490805_67490825dup
  • NG_008969.1:g.12772_12792dup
  • NM_001302959.2:c.628_648dup
  • NM_001302960.2:c.797_817dup
  • NM_003977.4:c.805_825dupMANE SELECT
  • NP_001289888.1:p.Phe210_His216dup
  • NP_001289889.1:p.Leu266_Pro272dup
  • NP_003968.3:p.Phe269_His275dup
  • LRG_460t1:c.805_825dup
  • LRG_460:g.12772_12792dup
  • NC_000011.9:g.67258273_67258274insACTTCAAGCGGGGCAAGGCCC
  • NC_000011.9:g.67258276_67258296dup
  • NM_003977.2:c.805_825dupTTCAAGCGGGGCAAGGCCCAC
Links:
dbSNP: rs267606578
NCBI 1000 Genomes Browser:
rs267606578
Molecular consequence:
  • NM_001302959.2:c.628_648dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001302960.2:c.797_817dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_003977.4:c.805_825dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001586343Invitaecriteria provided, single submitter
Pathogenic
(Jan 31, 2020)
germlineclinical testing

PubMed (3)
[See all records that cite these PMIDs]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Landscape of Familial Isolated and Young-Onset Pituitary Adenomas: Prospective Diagnosis in AIP Mutation Carriers.

Hernández-Ramírez LC, Gabrovska P, Dénes J, Stals K, Trivellin G, Tilley D, Ferrau F, Evanson J, Ellard S, Grossman AB, Roncaroli F, Gadelha MR, Korbonits M; International FIPA Consortium..

J Clin Endocrinol Metab. 2015 Sep;100(9):E1242-54.

PubMed [citation]
PMID:
26186299
PMCID:
PMC4570169

In-frame seven amino-acid duplication in AIP arose over the last 3000 years, disrupts protein interaction and stability and is associated with gigantism.

Salvatori R, Radian S, Diekmann Y, Iacovazzo D, David A, Gabrovska P, Grassi G, Bussell AM, Stals K, Weber A, Quinton R, Crowne EC, Corazzini V, Metherell L, Kearney T, Du Plessis D, Sinha AK, Baborie A, Lecoq AL, Chanson P, Ansorge O, Ellard S, et al.

Eur J Endocrinol. 2017 Sep;177(3):257-266. doi: 10.1530/EJE-17-0293. Epub 2017 Jun 20.

PubMed [citation]
PMID:
28634279
PMCID:
PMC5510572
See all PubMed Citations (3)

Details of each submission

From Invitae, SCV001586343.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (3)

Description

This variant, c.805_825dup, results in the insertion of 7 amino acid(s) to the AIP protein (p.Phe269_His275dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with pituitary adenoma (PMID: 26186299, 28634279). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 41208). This variant has been reported to affect AIP protein function (PMID: 28634279). For these reasons, this variant has been classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 24, 2021

Support Center