NM_000314.8(PTEN):c.802-51_802-14del AND PTEN hamartoma tumor syndrome

Clinical significance:Benign (Last evaluated: Mar 23, 2020)

Review status:3 stars out of maximum of 4 stars

reviewed by expert panel

Based on:
2 submissions [Details]
Record status:
current
Accession:
RCV001172262.2

Allele description [Variation Report for NM_000314.8(PTEN):c.802-51_802-14del]

NM_000314.8(PTEN):c.802-51_802-14del

Gene:
PTEN:phosphatase and tensin homolog [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
10q23.31
Genomic location:
Preferred name:
NM_000314.8(PTEN):c.802-51_802-14del
HGVS:
  • NC_000010.11:g.87960843_87960880del
  • NG_007466.2:g.102405_102442del
  • NM_000314.8:c.802-51_802-14delMANE SELECT
  • NM_001304717.5:c.1322-51_1322-14del
  • NM_001304718.2:c.211-51_211-14del
  • LRG_311t1:c.802-51_802-14del
  • LRG_311:g.102405_102442del
  • NC_000010.10:g.89720598_89720635del
  • NC_000010.10:g.89720600_89720637del
  • NM_000314.4:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT
  • NM_000314.6:c.802-51_802-14del
  • NM_000314.6:c.802-51_802-14del38
  • NM_000314.6:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT
  • NM_000314.7(PTEN):c.802-51_802-14del
Links:
dbSNP: rs557364463
NCBI 1000 Genomes Browser:
rs557364463
Molecular consequence:
  • NM_000314.8:c.802-51_802-14del - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304717.5:c.1322-51_1322-14del - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304718.2:c.211-51_211-14del - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Name:
PTEN hamartoma tumor syndrome (PHTS)
Synonyms:
PTEN Hamartomatous Tumour Syndrome
Identifiers:
MONDO: MONDO:0017623; MedGen: C1959582

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001335269ClinGen PTEN Variant Curation Expert Panelreviewed by expert panel
Benign
(Mar 23, 2020)
germlinecuration

Citation Link,

SCV001724760Invitaecriteria provided, single submitter
Benign
(Nov 30, 2020)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing, curation

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Details of each submission

From ClinGen PTEN Variant Curation Expert Panel, SCV001335269.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedcurationnot provided

Description

PTEN c.802-51_802-14del (IVS7-51_IVS7-14del) meets criteria to be classified as benign for PTEN Hamartoma Tumor syndrome in an autosomal dominant manner using modified ACMG criteria (PMID 30311380). Please see a summary of the rules and criteria codes in the "PTEN ACMG Specifications Summary" document (assertion method column). BA1: Allele frequency of 0.01931 (1.931%, 2747/142,290 alleles) in the global gnomAD cohort. (PMID 27535533)

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Invitae, SCV001724760.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Dec 2, 2021

Support Center