U.S. flag

An official website of the United States government

NM_001142800.2(EYS):c.9317_9336del (p.Thr3106fs) AND not provided

Germline classification:
Pathogenic (1 submission)
Last evaluated:
Jan 18, 2024
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001058261.7

Allele description [Variation Report for NM_001142800.2(EYS):c.9317_9336del (p.Thr3106fs)]

NM_001142800.2(EYS):c.9317_9336del (p.Thr3106fs)

Genes:
PHF3:PHD finger protein 3 [Gene - OMIM - HGNC]
EYS:eyes shut homolog [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
6q12
Genomic location:
Preferred name:
NM_001142800.2(EYS):c.9317_9336del (p.Thr3106fs)
HGVS:
  • NC_000006.12:g.63720695_63720714del
  • NG_023443.2:g.1991512_1991531del
  • NG_034034.2:g.89895_89914del
  • NM_001142800.2:c.9317_9336delMANE SELECT
  • NM_001290259.2:c.*6987_*7006del
  • NM_001292009.2:c.9380_9399del
  • NM_001370348.2:c.*6987_*7006delMANE SELECT
  • NM_001370349.2:c.*6987_*7006del
  • NM_001370350.2:c.*6987_*7006del
  • NM_015153.4:c.*6987_*7006del
  • NP_001136272.1:p.Thr3106fs
  • NP_001278938.1:p.Thr3127fs
  • NC_000006.11:g.64430591_64430610del
  • NC_000006.12:g.63720695_63720714delAATTTTGCCAACAAAATTGG
  • NM_001142800.1:c.9317_9336del20
Protein change:
T3106fs
Links:
dbSNP: rs1326370032
NCBI 1000 Genomes Browser:
rs1326370032
Molecular consequence:
  • NM_001290259.2:c.*6987_*7006del - 3 prime UTR variant - [Sequence Ontology: SO:0001624]
  • NM_001370348.2:c.*6987_*7006del - 3 prime UTR variant - [Sequence Ontology: SO:0001624]
  • NM_001370349.2:c.*6987_*7006del - 3 prime UTR variant - [Sequence Ontology: SO:0001624]
  • NM_001370350.2:c.*6987_*7006del - 3 prime UTR variant - [Sequence Ontology: SO:0001624]
  • NM_015153.4:c.*6987_*7006del - 3 prime UTR variant - [Sequence Ontology: SO:0001624]
  • NM_001142800.2:c.9317_9336del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001292009.2:c.9380_9399del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: C3661900

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001222819Labcorp Genetics (formerly Invitae), Labcorp
criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))
Pathogenic
(Jan 18, 2024)
germlineclinical testing

PubMed (7)
[See all records that cite these PMIDs]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Identification of a 2 Mb human ortholog of Drosophila eyes shut/spacemaker that is mutated in patients with retinitis pigmentosa.

Collin RW, Littink KW, Klevering BJ, van den Born LI, Koenekoop RK, Zonneveld MN, Blokland EA, Strom TM, Hoyng CB, den Hollander AI, Cremers FP.

Am J Hum Genet. 2008 Nov;83(5):594-603. doi: 10.1016/j.ajhg.2008.10.014. Epub 2008 Oct 30.

PubMed [citation]
PMID:
18976725
PMCID:
PMC2668042

EYS is a major gene for rod-cone dystrophies in France.

Audo I, Sahel JA, Mohand-Saïd S, Lancelot ME, Antonio A, Moskova-Doumanova V, Nandrot EF, Doumanov J, Barragan I, Antinolo G, Bhattacharya SS, Zeitz C.

Hum Mutat. 2010 May;31(5):E1406-35. doi: 10.1002/humu.21249.

PubMed [citation]
PMID:
20333770
See all PubMed Citations (7)

Details of each submission

From Labcorp Genetics (formerly Invitae), Labcorp, SCV001222819.5

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (7)

Description

This sequence change creates a premature translational stop signal (p.Thr3106Lysfs*13) in the EYS gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 39 amino acid(s) of the EYS protein. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This premature translational stop signal has been observed in individual(s) with an EYS-related condition (PMID: 29550188). ClinVar contains an entry for this variant (Variation ID: 557700). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the EYS protein in which other variant(s) (p.Val3096Leufs*28) have been determined to be pathogenic (PMID: 18976725, 20333770, 24474277, 25356976, 26261414, 29550188). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 8, 2024