NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs) AND multiple conditions

Clinical significance:Pathogenic

Review status:(0/4) 0 stars out of maximum of 4 stars

no assertion criteria provided

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV001003812.1

Allele description [Variation Report for NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)]

NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)

Gene:
ASXL1:ASXL transcriptional regulator 1 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
20q11.21
Genomic location:
Preferred name:
NM_015338.6(ASXL1):c.1900_1922del (p.Glu635fs)
HGVS:
  • NC_000020.11:g.32434612_32434634del
  • NG_027868.1:g.81269_81291del
  • NM_001363734.1:c.1717_1739del
  • NM_015338.6:c.1900_1922delMANE SELECT
  • NP_001350663.1:p.Glu574fs
  • NP_056153.2:p.Glu635fs
  • LRG_630t1:c.1900_1922del
  • LRG_630:g.81269_81291del
  • NC_000020.10:g.31022415_31022437del
  • NM_015338.5:c.1900_1922delAGAGAGGCGGCCACCACTGCCAT
Protein change:
E574fs
Links:
dbSNP: rs766433101
NCBI 1000 Genomes Browser:
rs766433101
Molecular consequence:
  • NM_001363734.1:c.1717_1739del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_015338.6:c.1900_1922del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:
Juvenile myelomonocytic leukemia (JMML)
Synonyms:
LEUKEMIA, JUVENILE MYELOMONOCYTIC, SOMATIC
Identifiers:
MONDO: MONDO:0011908; MedGen: C0349639; Orphanet: 86834; OMIM: 607785; Human Phenotype Ontology: HP:0012209
Name:
Cafe-au-lait spot
Synonyms:
Café au Lait; Café-au-lait spot
Identifiers:
MedGen: C0221263; Human Phenotype Ontology: HP:0000957

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001162262NIHR Bioresource Rare Diseases, University of Cambridgeno assertion criteria providedPathogenicunknownresearch

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedunknownyes1not providednot provided1not providedresearch

Citations

PubMed

Whole-genome sequencing of patients with rare diseases in a national health system.

Turro E, Astle WJ, Megy K, Gräf S, Greene D, Shamardina O, Allen HL, Sanchis-Juan A, Frontini M, Thys C, Stephens J, Mapeta R, Burren OS, Downes K, Haimel M, Tuna S, Deevi SVV, Aitman TJ, Bennett DL, Calleja P, Carss K, Caulfield MJ, et al.

Nature. 2020 Jul;583(7814):96-102. doi: 10.1038/s41586-020-2434-2. Epub 2020 Jun 24.

PubMed [citation]
PMID:
32581362
PMCID:
PMC7610553

Details of each submission

From NIHR Bioresource Rare Diseases, University of Cambridge, SCV001162262.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not provided1not providednot providedresearch PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownyes1not providednot provided1not providednot providednot provided

Last Updated: Nov 20, 2021

Support Center