NM_000020.2(ACVRL1):c.1027_1047del (p.Gln343_Leu349del) AND Telangiectasia, hereditary hemorrhagic, type 2

Clinical significance:Uncertain significance (Last evaluated: Sep 24, 2018)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000814801.1

Allele description [Variation Report for NM_000020.2(ACVRL1):c.1027_1047del (p.Gln343_Leu349del)]

NM_000020.2(ACVRL1):c.1027_1047del (p.Gln343_Leu349del)

Gene:
ACVRL1:activin A receptor like type 1 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
12q13.13
Genomic location:
Preferred name:
NM_000020.2(ACVRL1):c.1027_1047del (p.Gln343_Leu349del)
HGVS:
  • NC_000012.12:g.51915479_51915499del
  • NG_009549.1:g.13062_13082del
  • NM_000020.2:c.1027_1047del
  • NM_001077401.2:c.1027_1047del
  • NP_000011.2:p.Gln343_Leu349del
  • NP_001070869.1:p.Gln343_Leu349del
  • LRG_543t1:c.1027_1047del
  • LRG_543:g.13062_13082del
  • LRG_543p1:p.Gln343_Leu349del
  • NC_000012.11:g.52309263_52309283del
  • NM_000020.2:c.1027_1047delCAGTGTTGCATCGCCGACCTG
Links:
dbSNP: rs1592224385
NCBI 1000 Genomes Browser:
rs1592224385
Molecular consequence:
  • NM_000020.2:c.1027_1047del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001077401.2:c.1027_1047del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:
Telangiectasia, hereditary hemorrhagic, type 2 (HHT2)
Synonyms:
Telangiectasia, hereditary hemorrhagic, type II; Osler Weber Rendu syndrome type 2
Identifiers:
MONDO: MONDO:0010880; MedGen: C1838163; Orphanet: 774; OMIM: 600376

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000955228Invitaecriteria provided, single submitter
Uncertain significance
(Sep 24, 2018)
germlineclinical testing

PubMed (8)
[See all records that cite these PMIDs]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

High frequency of ENG and ALK1/ACVRL1 mutations in German HHT patients.

Schulte C, Geisthoff U, Lux A, Kupka S, Zenner HP, Blin N, Pfister M.

Hum Mutat. 2005 Jun;25(6):595.

PubMed [citation]
PMID:
15880681

Molecular and functional analysis identifies ALK-1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic telangiectasia.

Harrison RE, Flanagan JA, Sankelo M, Abdalla SA, Rowell J, Machado RD, Elliott CG, Robbins IM, Olschewski H, McLaughlin V, Gruenig E, Kermeen F, Halme M, Räisänen-Sokolowski A, Laitinen T, Morrell NW, Trembath RC.

J Med Genet. 2003 Dec;40(12):865-71. Erratum in: J Med Genet. 2004 Jul;41(7):576.

PubMed [citation]
PMID:
14684682
PMCID:
PMC1735342
See all PubMed Citations (8)

Details of each submission

From Invitae, SCV000955228.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (8)

Description

This variant, c.1027_1047delCAGTGTTGCATCGCCGACCTG, results in the deletion of 7 amino acid(s) of the ACVRL1 protein (p.Gln343_Leu349del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with ACVRL1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant disrupts the p.Cys344 amino acid residue in ACVRL1. Other variant(s) that disrupt this residue have been observed in affected individuals (PMID: 10767348, 14684682, 15880681, 16542389, 17384219, 12114496, 16282348), suggesting that it is a clinically significant residue. As a result, variants that disrupt this residue are likely to be causative of disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 7, 2021

Support Center