NM_000382.3(ALDH3A2):c.25_50del (p.Arg9fs) AND not provided

Clinical significance:Pathogenic (Last evaluated: Oct 3, 2018)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000791516.1

Allele description [Variation Report for NM_000382.3(ALDH3A2):c.25_50del (p.Arg9fs)]

NM_000382.3(ALDH3A2):c.25_50del (p.Arg9fs)

Gene:
ALDH3A2:aldehyde dehydrogenase 3 family member A2 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
17p11.2
Genomic location:
Preferred name:
NM_000382.3(ALDH3A2):c.25_50del (p.Arg9fs)
HGVS:
  • NC_000017.11:g.19648996_19649021del
  • NG_007095.2:g.5246_5271del
  • NM_000382.3:c.25_50delMANE SELECT
  • NM_001031806.2:c.25_50del
  • NM_001369136.1:c.25_50del
  • NM_001369137.1:c.25_50del
  • NM_001369138.1:c.25_50del
  • NM_001369139.1:c.25_50del
  • NM_001369146.1:c.25_50del
  • NM_001369148.1:c.-664_-639del
  • NP_000373.1:p.Arg9fs
  • NP_001026976.1:p.Arg9fs
  • NP_001356065.1:p.Arg9fs
  • NP_001356066.1:p.Arg9fs
  • NP_001356067.1:p.Arg9fs
  • NP_001356068.1:p.Arg9fs
  • NP_001356075.1:p.Arg9fs
  • NC_000017.10:g.19552309_19552334del
  • NM_000382.2:c.25_50del26
  • NM_000382.2:c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC
  • NM_000382.3:c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTCMANE SELECT
Protein change:
R9fs
Links:
dbSNP: rs767751416
NCBI 1000 Genomes Browser:
rs767751416
Molecular consequence:
  • NM_001369148.1:c.-664_-639del - 5 prime UTR variant - [Sequence Ontology: SO:0001623]
  • NM_000382.3:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001031806.2:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001369136.1:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001369137.1:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001369138.1:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001369139.1:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001369146.1:c.25_50del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000930768Invitaecriteria provided, single submitter
Pathogenic
(Oct 3, 2018)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Details of each submission

From Invitae, SCV000930768.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

This sequence change creates a premature translational stop signal (p.Arg9Alafs*36) in the ALDH3A2 gene. It is expected to result in an absent or disrupted protein product. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has been observed to segregate with Sjögren-Larsson syndrome in a family (PMID: 29183715). ClinVar contains an entry for this variant (Variation ID: 371103). Loss-of-function variants in ALDH3A2 are known to be pathogenic (PMID: 10577908, 10854114). For these reasons, this variant has been classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Aug 27, 2021

Support Center