NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) AND not provided

Clinical significance:Uncertain significance (Last evaluated: Jun 6, 2016)

Review status:(0/4) 0 stars out of maximum of 4 stars

no assertion criteria provided

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000786342.1

Allele description [Variation Report for NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])]

NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])

Gene:
LDB3:LIM domain binding 3 [Gene - OMIM - HGNC]
Variant type:
Microsatellite
Cytogenetic location:
10q23.2
Genomic location:
Preferred name:
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])
HGVS:
  • NC_000010.11:g.86716391CCCTGCCCCTGCCTACACCCCCTC[1]
  • NG_008876.1:g.52828CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001080114.2:c.966CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001171610.2:c.1311CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001368064.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001368065.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001368066.1:c.1155CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_007078.3:c.1296CCCTGCCCCTGCCTACACCCCCTC[1]MANE SELECT
  • NP_001073583.1:p.324APAYTPSP[1]
  • NP_001165081.1:p.439APAYTPSP[1]
  • NP_001354993.1:p.371APAYTPSP[1]
  • NP_001354994.1:p.371APAYTPSP[1]
  • NP_001354995.1:p.387APAYTPSP[1]
  • NP_009009.1:p.434APAYTPSP[1]
  • LRG_385t1:c.1320_1343del24
  • LRG_385:g.52828CCCTGCCCCTGCCTACACCCCCTC[1]
  • NC_000010.10:g.88476135_88476158del
  • NC_000010.10:g.88476148CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_007078.2:c.1320_1343del24
  • NM_007078.2:c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC
  • c.1320_1343del
Links:
dbSNP: rs397517209
NCBI 1000 Genomes Browser:
rs397517209
Molecular consequence:
  • NM_001080114.2:c.966CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001171610.2:c.1311CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001368064.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001368065.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001368066.1:c.1155CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_007078.3:c.1296CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000925120Stanford Center for Inherited Cardiovascular Disease, Stanford Universityno assertion criteria providedUncertain significance
(Jun 6, 2016)
germlineprovider interpretation

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedprovider interpretation

Details of each submission

From Stanford Center for Inherited Cardiovascular Disease, Stanford University, SCV000925120.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedprovider interpretationnot provided

Description

c.1320_1343del (p.Ala442_Pro449del) in LDB3 Given the lack of case data and location of the in-frame deletion in a region of repetitive sequence within the gene, we consider this variant to be of uncertain significance and we do not feel it is suitable for assessing risk in healthy relatives ("predictive genetic testing"). The variant has been seen in at least 1 unrelated case of DCM (not including this patient's family). We have seen the variant in a patient with DCM and a very likely pathogenic LMNA variant. Testing was done by Invitae. Pugh et al., 2014 reported the variant in an individual with DCM. The Invitae report notes, "This sequence change deletes 24 nucleotides from exon 9 of the LDB3 mRNA (c.1320_1343del). This leads to the deletion of 8 amino acid residue(s) in the LDB3 protein (p.Ala442_Pro449del) but otherwise preserves the integrity of the reading frame...The functional effect of in-frame deletions in LDB3 is unknown." This variant is absent from ExAC, the Exome Aggregation Consortium dataset (http://exac.broadinstitute.org/), which currently includes variant calls on ~64,000 individuals of European, African, Latino and Asian descent (as of 6/6/2016). The mean coverage at that site in ExAC is 16x to ~20x.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Jul 7, 2021

Support Center