NM_001374828.1(ARID1B):c.594GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln207_Gln214dup) AND History of neurodevelopmental disorder
- Germline classification:
- Likely benign (1 submission)
- Last evaluated:
- Sep 16, 2016
- Review status:
- Somatic classification
of clinical impact: - None
- Review status:
- Somatic classification
of oncogenicity: - None
- Review status:
- Record status:
- current
- Accession:
- RCV000718960.2
Allele description
NM_001374828.1(ARID1B):c.594GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln207_Gln214dup)
Condition(s)
- Name:
- History of neurodevelopmental disorder
- Identifiers:
- MedGen: C2711754
Assertion and evidence details
Last Updated: Aug 23, 2022