NM_001127644.2(GABRA1):c.869_888del (p.Val290fs) AND multiple conditions

Clinical significance:Pathogenic (Last evaluated: Jun 19, 2018)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:

Allele description [Variation Report for NM_001127644.2(GABRA1):c.869_888del (p.Val290fs)]

NM_001127644.2(GABRA1):c.869_888del (p.Val290fs)

GABRA1:gamma-aminobutyric acid type A receptor subunit alpha1 [Gene - OMIM - HGNC]
Variant type:
Cytogenetic location:
Genomic location:
Preferred name:
NM_001127644.2(GABRA1):c.869_888del (p.Val290fs)
  • NC_000005.10:g.161895678_161895697del
  • NG_011548.1:g.53488_53507del
  • NM_000806.5:c.869_888del
  • NM_001127643.2:c.869_888del
  • NM_001127644.2:c.869_888delMANE SELECT
  • NM_001127645.2:c.869_888del
  • NM_001127648.2:c.869_888del
  • NP_000797.2:p.Val290fs
  • NP_001121115.1:p.Val290fs
  • NP_001121116.1:p.Val290fs
  • NP_001121117.1:p.Val290fs
  • NP_001121120.1:p.Val290fs
  • NC_000005.9:g.161322684_161322703del
  • NM_000806.5:c.869_888delTGCTCACCATGACAACATTG
Protein change:
dbSNP: rs1561587715
NCBI 1000 Genomes Browser:
Molecular consequence:
  • NM_000806.5:c.869_888del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001127643.2:c.869_888del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001127644.2:c.869_888del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001127645.2:c.869_888del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001127648.2:c.869_888del - frameshift variant - [Sequence Ontology: SO:0001589]


Idiopathic generalized epilepsy
EIG; Generalised epilepsy
MONDO: MONDO:0005579; MedGen: C0270850; OMIM: 600669; OMIM: PS600669
Epilepsy, juvenile myoclonic 5 (EIG13)
MONDO: MONDO:0012627; MedGen: C4013473; Orphanet: 307; Orphanet: 64280; OMIM: 611136
Epilepsy, childhood absence 4 (ECA4)
MedGen: C1970160; Orphanet: 307

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
SCV000816297Invitaecriteria provided, single submitter
(Jun 19, 2018)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing



Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]

Details of each submission

From Invitae, SCV000816297.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)


This sequence change creates a premature translational stop signal (p.Val290Glufs*10) in the GABRA1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with GABRA1-related disease. Loss-of-function variants in GABRA1 are known to be pathogenic (PMID: 16718694). For these reasons, this variant has been classified as Pathogenic.

OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Nov 27, 2021

Support Center