NM_000046.5(ARSB):c.1534_1556del (p.Val512fs) AND Mucopolysaccharidosis type 6

Germline classification:: Pathogenic (5 submissions)
Last evaluated:: Sep 5, 2023
Review status:: 2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000677496.11

Allele description [Variation Report for NM_000046.5(ARSB):c.1534_1556del (p.Val512fs)]

NM_000046.5(ARSB):c.1534_1556del (p.Val512fs)

Gene:

ARSB:arylsulfatase B [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

5q14.1

Genomic location:

Preferred name:

NM_000046.5(ARSB):c.1534_1556del (p.Val512fs)

HGVS:

NC_000005.10:g.78780446_78780468del
NG_007089.1:g.211070_211092del
NM_000046.5:c.1534_1556delMANE SELECT
NP_000037.2:p.Val512fs
NC_000005.10:g.78780443_78780465delGGGTCCTGTGCAGGGAAGTACAC
NC_000005.9:g.78076266_78076288del
NC_000005.9:g.78076269_78076291del
NM_000046.3:c.1534_1556del23
NM_000046.4:c.1534_1556del

Protein change:

V512fs

Links:

dbSNP: rs1310996698

NCBI 1000 Genomes Browser:

rs1310996698

Molecular consequence:

NM_000046.5:c.1534_1556del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:: Mucopolysaccharidosis type 6 (MPS6)
Synonyms:: ARSB DEFICIENCY; ARYLSULFATASE B DEFICIENCY; MPS VI; See all synonyms [MedGen]
Identifiers:: MONDO: MONDO:0009661; MedGen: C0026709; Orphanet: 583; OMIM: 253200

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV001623154	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015)	Pathogenic (May 13, 2021)	germline	clinical testing	PubMed (4) [See all records that cite these PMIDs] 17458871, 16435196, 26909334, 15000815 Citation Link,
SCV002518521	Mendelics	criteria provided, single submitter (Mendelics Assertion Criteria 2019)	Pathogenic (May 4, 2022)	germline	clinical testing	Citation Link,
SCV003455707	Labcorp Genetics (formerly Invitae), Labcorp	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Pathogenic (Mar 13, 2023)	germline	clinical testing	PubMed (4) [See all records that cite these PMIDs] 17458871, 8116615, 24677745, 28492532
SCV004209147	Baylor Genetics	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (Sep 5, 2023)	unknown	clinical testing	PubMed (1) [See all records that cite this PMID]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing
not provided	unknown	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing
not provided	germline	yes	not provided	not provided	not provided	not provided	not provided	curation

Citations

PubMed

Skeletal complications in mucopolysaccharidosis VI patients: Case reports.

Garcia P, Sousa SB, Ling TP, Conceição M, Seabra J, White KK, Diogo L.

J Pediatr Rehabil Med. 2010;3(1):63-9. doi: 10.3233/PRM-2010-0108.

PubMed [citation]

PMID:: 21791831

Mucopolysaccharidosis type VI (MPS VI) and molecular analysis: Review and classification of published variants in the ARSB gene.

Tomanin R, Karageorgos L, Zanetti A, Al-Sayed M, Bailey M, Miller N, Sakuraba H, Hopwood JJ.

Hum Mutat. 2018 Dec;39(12):1788-1802. doi: 10.1002/humu.23613. Epub 2018 Sep 17. Review.

PubMed [citation]

PMID:: 30118150
PMCID:: PMC6282714

See all PubMed Citations (10)

Details of each submission

From Laboratory of Diagnosis and Therapy of Lysosomal Disorders, University of Padova, SCV000803006.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	curation	PubMed (6)

Description

Absent from GnomAD (PM2

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV001623154.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (4)

Description

Variant summary: ARSB c.1534_1556del23 (p.Val512ProfsX3) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant allele was found at a frequency of 4e-06 in 251598 control chromosomes (gnomAD and publication data). c.1534_1556del23 has been reported in the literature in multiple individuals affected with Mucopolysaccharidosis Type VI (Maroteaux-Lamy Syndrome), including two homozygotes (Petry_2003, Petry_2005, Karageorgos_2007, Giraldo_2015). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. One ClinVar submitter (evaluation after 2014) cites the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Mendelics, SCV002518521.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	not provided

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Labcorp Genetics (formerly Invitae), Labcorp, SCV003455707.2

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (4)

Description

This sequence change creates a premature translational stop signal (p.Val512Profs*3) in the ARSB gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 22 amino acid(s) of the ARSB protein. This variant is present in population databases (no rsID available, gnomAD 0.0009%). ClinVar contains an entry for this variant (Variation ID: 559721). This premature translational stop signal has been observed in individual(s) with mucopolysaccharidosis type VI (PMID: 17458871). For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the ARSB protein in which other variant(s) (p.Thr526Metfs*48) have been determined to be pathogenic (PMID: 8116615, 24677745). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Baylor Genetics, SCV004209147.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (1)

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	unknown	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Flagged submissions

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000803006	Laboratory of Diagnosis and Therapy of Lysosomal Disorders, University of Padova	flagged submission Reason: Outlier claim with insufficient supporting evidence Notes: None (ACMG Guidelines, 2015)	Uncertain significance (Jan 1, 2018)	germline	curation	PubMed (6) [See all records that cite these PMIDs] 16435196, 17458871, 21791831, 26909334, 25741868, 30118150

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000803006

Laboratory of Diagnosis and Therapy of Lysosomal Disorders, University of Padova

flagged submission

Reason: Outlier claim with insufficient supporting evidence

Notes: None

(ACMG Guidelines, 2015)

Uncertain significance
(Jan 1, 2018)

germline

curation

PubMed (6)
[See all records that cite these PMIDs]

Last Updated: Jan 13, 2025

ClinVar

Relating variation to medicine