U.S. flag

An official website of the United States government

NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del) AND Atrial fibrillation, familial, 7

Germline classification:
Conflicting interpretations of pathogenicity (3 submissions)
Last evaluated:
Dec 4, 2023
Review status:
criteria provided, conflicting classifications
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000646136.21

Allele description [Variation Report for NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del)]

NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del)

Gene:
KCNA5:potassium voltage-gated channel subfamily A member 5 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
12p13.32
Genomic location:
Preferred name:
NM_002234.4(KCNA5):c.213_245del (p.Asp72_Pro82del)
HGVS:
  • NC_000012.11:g.5153498_5153530del
  • NC_000012.12:g.5044360_5044392del
  • NG_012198.1:g.5442_5474del
  • NM_002234.4:c.213_245delMANE SELECT
  • NP_002225.2:p.Asp72_Pro82del
  • NC_000012.11:g.5153498_5153530del
  • NC_000012.11:g.5153526_5153558del
  • NC_000012.11:g.5153526_5153558delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC
  • NM_002234.2:c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC
  • NM_002234.3:c.213_245del
  • NM_002234.3:c.213_245delGGACCCGGGAGTGCGGCCCTTGCCTCCGCTGCC
Links:
dbSNP: rs144879674
NCBI 1000 Genomes Browser:
rs144879674
Molecular consequence:
  • NM_002234.4:c.213_245del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:
Atrial fibrillation, familial, 7 (ATFB7)
Identifiers:
MONDO: MONDO:0012828; MedGen: C2677106; OMIM: 612240

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000767893Invitae
criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))
Likely benign
(Dec 4, 2023)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

SCV001474433ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
criteria provided, single submitter

(ARUP Molecular Germline Variant Investigation Process)
Uncertain significance
(Sep 15, 2019)
germlineclinical testing

Citation Link,

SCV003813979Revvity Omics, Revvity
criteria provided, single submitter

(ACMG Guidelines, 2015)
Uncertain significance
(Feb 2, 2022)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240. doi: 10.1038/s41436-019-0624-9.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee..

Genet Med. 2015 May;17(5):405-24. doi: 10.1038/gim.2015.30. Epub 2015 Mar 5.

PubMed [citation]
PMID:
25741868
PMCID:
PMC4544753

Details of each submission

From Invitae, SCV000767893.7

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories, SCV001474433.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The KCNA5 c.213_245del, p.Asp72_Pro82del variant (rs144879674) is reported in the literature in two probands affected with atrial fibrillation as well as three affected relatives (Yang 2010). This variant results in an in-frame deletion of 11 residues that encompass a predicted Src SH2 domain binding motif and functional analysis demonstrated that this variant reduces channel activity; however, the clinical relevance of this observation is unknown. (Yang 2010). This variant is reported in ClinVar (Variation ID: 537316) and is found in the general population with an overall allele frequency of 0.079% (147/185,166 alleles) and a South Asian allele frequency of 0.24% in the Genome Aggregation Database. Due to limited information, the clinical significance of this variant is uncertain at this time.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Revvity Omics, Revvity, SCV003813979.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Mar 16, 2024