NM_000251.2(MSH2):c.1077-66_1146del AND Hereditary nonpolyposis colorectal neoplasms

Clinical significance:Pathogenic (Last evaluated: Sep 27, 2017)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000630184.1

Allele description [Variation Report for NM_000251.2(MSH2):c.1077-66_1146del]

NM_000251.2(MSH2):c.1077-66_1146del

Gene:
MSH2:mutS homolog 2 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
2p21
Genomic location:
Preferred name:
NM_000251.2(MSH2):c.1077-66_1146del
HGVS:
  • NC_000002.12:g.47429676_47429811del
  • NG_007110.2:g.31553_31688del
  • NM_000251.2:c.1077-66_1146del
  • NM_001258281.1:c.879-66_948del
  • LRG_218t1:c.1077-66_1146del
  • LRG_218:g.31553_31688del
  • NC_000002.11:g.47656815_47656950del
  • NM_000251.1:c.1077-69_1143del
  • NM_000251.2:c.1077-66_1146delGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTTCGT
Links:
dbSNP: rs193922372
NCBI 1000 Genomes Browser:
rs193922372
Molecular consequence:
  • NM_000251.2:c.1077-66_1146del - splice acceptor variant - [Sequence Ontology: SO:0001574]
  • NM_001258281.1:c.879-66_948del - splice acceptor variant - [Sequence Ontology: SO:0001574]

Condition(s)

Name:
Hereditary nonpolyposis colorectal neoplasms
Identifiers:
MedGen: C0009405; Orphanet: 443090

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000751140Invitaecriteria provided, single submitter
Pathogenic
(Sep 27, 2017)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Details of each submission

From Invitae, SCV000751140.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

This variant is an out-of-frame deletion of the genomic region encompassing part of exon 7 of the MSH2 gene, including the intron 6-exon 7 boundary (c.1077-66_1146del). This is expected to create a premature translational stop signal and result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MSH2-related disease. Loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). For these reasons, this variant has been classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Jun 14, 2021

Support Center