NM_000277.3(PAH):c.592_613del (p.Tyr198fs) AND Phenylketonuria

Clinical significance:Pathogenic (Last evaluated: Jun 21, 2020)

Review status:2 stars out of maximum of 4 stars

criteria provided, multiple submitters, no conflicts

Based on:
3 submissions [Details]
Record status:
current
Accession:
RCV000587795.4

Allele description [Variation Report for NM_000277.3(PAH):c.592_613del (p.Tyr198fs)]

NM_000277.3(PAH):c.592_613del (p.Tyr198fs)

Gene:
PAH:phenylalanine hydroxylase [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
12q23.2
Genomic location:
Preferred name:
NM_000277.3(PAH):c.592_613del (p.Tyr198fs)
HGVS:
  • NC_000012.12:g.102855231_102855252del
  • NG_008690.2:g.108161_108182del
  • NM_000277.1:c.592_613delTATAAAACCCATGCTTGCTATG
  • NM_000277.3:c.592_613delMANE SELECT
  • NM_001354304.2:c.592_613del
  • NP_000268.1:p.Tyr198fs
  • NP_001341233.1:p.Tyr198fs
  • NC_000012.11:g.103249007_103249028del
  • NC_000012.11:g.103249009_103249030del
  • NM_000277.1:c.592_613del
  • NM_000277.1:c.592_613del22
  • NM_000277.1:c.592_613delTATAAAACCCATGCTTGCTATG
Protein change:
Y198fs
Links:
dbSNP: rs199475697
NCBI 1000 Genomes Browser:
rs199475697
Molecular consequence:
  • NM_000277.3:c.592_613del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001354304.2:c.592_613del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:
Phenylketonuria (PKU)
Synonyms:
Phenylketonurias; Oligophrenia phenylpyruvica; Folling disease
Identifiers:
MONDO: MONDO:0009861; MedGen: C0031485; Orphanet: 716; OMIM: 261600

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000696457Women's Health and Genetics/Laboratory Corporation of America, LabCorpcriteria provided, single submitter
Pathogenic
(Jan 21, 2016)
germlineclinical testing

PubMed (4)
[See all records that cite these PMIDs]

LabCorp Variant Classification Summary - May 2015.docx,

Citation Link,

SCV001132446Counsylno assertion criteria providedLikely pathogenic
(Feb 25, 2014)
unknownclinical testing

SCV001209421Invitaecriteria provided, single submitter
Pathogenic
(Jun 21, 2020)
germlineclinical testing

PubMed (6)
[See all records that cite these PMIDs]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing
not providedunknownunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Molecular genetics and impact of residual in vitro phenylalanine hydroxylase activity on tetrahydrobiopterin responsiveness in Turkish PKU population.

Dobrowolski SF, Heintz C, Miller T, Ellingson C, Ellingson C, Ozer I, Gökçay G, Baykal T, Thöny B, Demirkol M, Blau N.

Mol Genet Metab. 2011 Feb;102(2):116-21. doi: 10.1016/j.ymgme.2010.11.158. Epub 2010 Nov 18.

PubMed [citation]
PMID:
21147011

Functional and structural characterization of novel mutations and genotype-phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy.

Daniele A, Scala I, Cardillo G, Pennino C, Ungaro C, Sibilio M, Parenti G, Esposito L, Zagari A, Andria G, Salvatore F.

FEBS J. 2009 Apr;276(7):2048-59. doi: 10.1111/j.1742-4658.2009.06940.x.

PubMed [citation]
PMID:
19292873
See all PubMed Citations (9)

Details of each submission

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV000696457.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (4)

Description

Variant summary: This c.592_613del22 variant causes a frameshift, which alters the proteins amino acid sequence beginning at position 198 and leads to a premature termination codon 136 amino acids downstream. It is predicted to cause a truncated or absent PAH protein. Loss-of-function due to mutations in this gene is an established disease mechanism in Phenylketoneuria. This variant was not found in approximately 121322 chromosomes from the broad and large populations of ExAC. This variant has been recurrently reported as a causative mutation in patients with Phenylketoneuria. The region this variant is located is a mutational hot-spot where other similar pathogenic frameshift variants (such as c.586del22, c.589del22, c.590del23 and c.593del22) (source: HGMD) have been reported. Reputable databases have also classified this variant as pathogenic. Taken together, this variant has been classified as a Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Counsyl, SCV001132446.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownunknownnot providednot providednot providednot providednot providednot providednot provided

From Invitae, SCV001209421.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (6)

Description

This sequence change creates a premature translational stop signal (p.Tyr198Serfs*136) in the PAH gene. It is expected to result in an absent or disrupted protein product. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has been observed in individuals with phenylketonuria or hyperphenylalaninemia (PMID: 24301756, 21890392, 9359039). In at least one individual the data is consistent with the variant being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 102746). Loss-of-function variants in PAH are known to be pathogenic (PMID: 1301187, 9634518). For these reasons, this variant has been classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 6, 2021

Support Center