NM_000363.5(TNNI3):c.485_514del (p.Arg162_Ala171del) AND Hypertrophic cardiomyopathy

Clinical significance:Uncertain significance (Last evaluated: Mar 16, 2017)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000551389.1

Allele description [Variation Report for NM_000363.5(TNNI3):c.485_514del (p.Arg162_Ala171del)]

NM_000363.5(TNNI3):c.485_514del (p.Arg162_Ala171del)

Gene:
TNNI3:troponin I3, cardiac type [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
19q13.42
Genomic location:
Preferred name:
NM_000363.5(TNNI3):c.485_514del (p.Arg162_Ala171del)
HGVS:
  • NC_000019.10:g.55154071_55154100del
  • NG_007866.2:g.8639_8668del
  • NG_011829.2:g.145_174del
  • NM_000363.5:c.485_514delMANE SELECT
  • NP_000354.4:p.Arg162_Ala171del
  • LRG_432t1:c.485_514del
  • LRG_432:g.8639_8668del
  • LRG_679:g.145_174del
  • NC_000019.9:g.55665439_55665468del
  • NM_000363.4:c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC
Links:
dbSNP: rs1555863489
NCBI 1000 Genomes Browser:
rs1555863489
Molecular consequence:
  • NM_000363.5:c.485_514del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:
Hypertrophic cardiomyopathy
Identifiers:
MONDO: MONDO:0005045; MeSH: D002312; MedGen: C0007194; OMIM: PS192600; Human Phenotype Ontology: HP:0001639

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000623786Invitaecriteria provided, single submitter
Uncertain significance
(Mar 16, 2017)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Details of each submission

From Invitae, SCV000623786.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

This sequence change deletes 30 nucleotides from exon 7 of the TNNI3 mRNA (c.485_514del30). This leads to the deletion of 10 amino acid residues in the TNNI3 protein (p.Arg162_Ala171del) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a TNNI3-related disease. Experimental studies and prediction algorithms are not available for this variant. Two missense substitutions at codons 162 and 170 (p.Arg162Gln and p.Arg170Trp) have been determined to be pathogenic (PMID: 15607392, 22876777, 20031618, 26440512). This suggests that these residues are critical for TNNI3 protein function and that their disruption due to this deletion at this position may also be pathogenic. In addition, this variant deletes part of the troponin C binding domain where other variants associated with restrictive and hypertrophic cardiomyopathy have been reported to occur (PMID: 26440512). In summary, this variant is an in-frame deletion that deletes amino acid residues important for TNNI3 protein function. However, the available genetic evidence is insufficient at this point to classify this variant conclusively. It has been classified as a Variant of Uncertain Significance.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 7, 2021

Support Center