NM_000020.2(ACVRL1):c.1250_1269del (p.Ile417fs) AND Telangiectasia, hereditary hemorrhagic, type 2

Clinical significance:Pathogenic (Last evaluated: Jul 7, 2017)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:

Allele description [Variation Report for NM_000020.2(ACVRL1):c.1250_1269del (p.Ile417fs)]

NM_000020.2(ACVRL1):c.1250_1269del (p.Ile417fs)

ACVRL1:activin A receptor like type 1 [Gene - OMIM - HGNC]
Variant type:
Cytogenetic location:
Genomic location:
Preferred name:
NM_000020.2(ACVRL1):c.1250_1269del (p.Ile417fs)
  • NC_000012.12:g.51918988_51919007del
  • NG_009549.1:g.16571_16590del
  • NM_000020.2:c.1250_1269del
  • NM_001077401.2:c.1250_1269del
  • NP_000011.2:p.Ile417fs
  • NP_001070869.1:p.Ile417fs
  • LRG_543t1:c.1250_1269del
  • LRG_543:g.16571_16590del
  • LRG_543p1:p.Ile417fs
  • NC_000012.11:g.52312772_52312791del
  • NM_000020.2:c.1250_1269delTCGTGGAGGACTATAGACCA
Protein change:
dbSNP: rs1555153796
NCBI 1000 Genomes Browser:
Molecular consequence:
  • NM_000020.2:c.1250_1269del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001077401.2:c.1250_1269del - frameshift variant - [Sequence Ontology: SO:0001589]


Telangiectasia, hereditary hemorrhagic, type 2 (HHT2)
Telangiectasia, hereditary hemorrhagic, type II; Osler Weber Rendu syndrome type 2
MONDO: MONDO:0010880; MedGen: C1838163; Orphanet: 774; OMIM: 600376

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
SCV000639390Invitaecriteria provided, single submitter
(Jul 7, 2017)
germlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing



Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]

Details of each submission

From Invitae, SCV000639390.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)


This sequence change deletes 20 nucleotides from exon 9 of the ACVRL1 mRNA (c.1250_1269delTCGTGGAGGACTATAGACCA), causing a frameshift at codon 417. This creates a premature translational stop signal (p.Ile417Thrfs*4) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in ACVRL1 are known to be pathogenic (PMID: 15879500). For these reasons, this variant has been classified as Pathogenic.

OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 7, 2021

Support Center