NM_000314.8(PTEN):c.802-51_802-14del AND Cowden syndrome 1

Clinical significance:Uncertain significance (Last evaluated: May 26, 2017)

Review status:(0/4) 0 stars out of maximum of 4 stars

no assertion criteria provided

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000516066.1

Allele description [Variation Report for NM_000314.8(PTEN):c.802-51_802-14del]

NM_000314.8(PTEN):c.802-51_802-14del

Gene:
PTEN:phosphatase and tensin homolog [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
10q23.31
Genomic location:
Preferred name:
NM_000314.8(PTEN):c.802-51_802-14del
HGVS:
  • NC_000010.11:g.87960843_87960880del
  • NG_007466.2:g.102405_102442del
  • NM_000314.8:c.802-51_802-14delMANE SELECT
  • NM_001304717.5:c.1322-51_1322-14del
  • NM_001304718.2:c.211-51_211-14del
  • LRG_311t1:c.802-51_802-14del
  • LRG_311:g.102405_102442del
  • NC_000010.10:g.89720598_89720635del
  • NC_000010.10:g.89720600_89720637del
  • NM_000314.4:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT
  • NM_000314.6:c.802-51_802-14del
  • NM_000314.6:c.802-51_802-14del38
  • NM_000314.6:c.802-51_802-14delAATTAAATATGTCATTTCATTTCTTTTTCTTTTCTTTT
  • NM_000314.7(PTEN):c.802-51_802-14del
Links:
dbSNP: rs557364463
NCBI 1000 Genomes Browser:
rs557364463
Molecular consequence:
  • NM_000314.8:c.802-51_802-14del - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304717.5:c.1322-51_1322-14del - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001304718.2:c.211-51_211-14del - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Name:
Cowden syndrome 1 (CWS1)
Identifiers:
MONDO: MONDO:0008021; MedGen: CN072330; OMIM: 158350

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000579256Cancer Genomic Medicine Translational Research Lab,Cleveland Clinic Genomic Medicine Instituteno assertion criteria providedUncertain significance
(May 26, 2017)
germlineresearch

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedresearch

Citations

PubMed

Characterization of cryptic splicing in germline PTEN intronic variants in Cowden syndrome.

Chen HJ, Romigh T, Sesock K, Eng C.

Hum Mutat. 2017 Oct;38(10):1372-1377. doi: 10.1002/humu.23288. Epub 2017 Jul 17.

PubMed [citation]
PMID:
28677221
PMCID:
PMC5599331

Details of each submission

From Cancer Genomic Medicine Translational Research Lab,Cleveland Clinic Genomic Medicine Institute, SCV000579256.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedresearch PubMed (1)
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Nov 10, 2021

Support Center