U.S. flag

An official website of the United States government

NM_000527.5(LDLR):c.1187G>A (p.Gly396Asp) AND Hypercholesterolemia, familial, 1

Germline classification:
Uncertain significance (2 submissions)
Last evaluated:
Oct 28, 2022
Review status:
3 stars out of maximum of 4 stars
reviewed by expert panel
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000508828.2

Allele description [Variation Report for NM_000527.5(LDLR):c.1187G>A (p.Gly396Asp)]

NM_000527.5(LDLR):c.1187G>A (p.Gly396Asp)

Gene:
LDLR:low density lipoprotein receptor [Gene - OMIM - HGNC]
Variant type:
single nucleotide variant
Cytogenetic location:
19p13.2
Genomic location:
Preferred name:
NM_000527.5(LDLR):c.1187G>A (p.Gly396Asp)
Other names:
NM_000527.5(LDLR):c.1187G>A; p.Gly396Asp
HGVS:
  • NC_000019.10:g.11113278G>A
  • NG_009060.1:g.28898G>A
  • NM_000527.5:c.1187G>AMANE SELECT
  • NM_001195798.2:c.1187G>A
  • NM_001195799.2:c.1064G>A
  • NM_001195800.2:c.683G>A
  • NM_001195803.2:c.806G>A
  • NP_000518.1:p.Gly396Asp
  • NP_000518.1:p.Gly396Asp
  • NP_001182727.1:p.Gly396Asp
  • NP_001182728.1:p.Gly355Asp
  • NP_001182729.1:p.Gly228Asp
  • NP_001182732.1:p.Gly269Asp
  • LRG_274t1:c.1187G>A
  • LRG_274:g.28898G>A
  • LRG_274p1:p.Gly396Asp
  • NC_000019.9:g.11223954G>A
  • NM_000527.4:c.1187G>A
Protein change:
G228D
Links:
dbSNP: rs766474188
NCBI 1000 Genomes Browser:
rs766474188
Molecular consequence:
  • NM_000527.5:c.1187G>A - missense variant - [Sequence Ontology: SO:0001583]
  • NM_001195798.2:c.1187G>A - missense variant - [Sequence Ontology: SO:0001583]
  • NM_001195799.2:c.1064G>A - missense variant - [Sequence Ontology: SO:0001583]
  • NM_001195800.2:c.683G>A - missense variant - [Sequence Ontology: SO:0001583]
  • NM_001195803.2:c.806G>A - missense variant - [Sequence Ontology: SO:0001583]

Condition(s)

Name:
Hypercholesterolemia, familial, 1
Synonyms:
LDL RECEPTOR DISORDER; Hyperlipoproteinemia Type IIa; HYPER-LOW-DENSITY-LIPOPROTEINEMIA; See all synonyms [MedGen]
Identifiers:
MONDO: MONDO:0007750; MedGen: C0745103; Orphanet: 391665; OMIM: 143890

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Help
Submission AccessionSubmitterReview Status
(Assertion method)		Clinical Significance
(Last evaluated)		OriginMethodCitations
SCV000606347Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum
no assertion criteria provided
Pathogenicgermlineresearch

SCV002817159ClinGen Familial Hypercholesterolemia Variant Curation Expert Panel
reviewed by expert panel

(ClinGen FH ACMG Specifications v1-2)		Uncertain significance
(Oct 28, 2022) 		germlinecuration

Citation Link

Help

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedresearch, curation

Details of each submission

From Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum, SCV000606347.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedresearchnot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From ClinGen Familial Hypercholesterolemia Variant Curation Expert Panel, SCV002817159.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedcurationnot provided

Description

The NM_000527.5 (LDLR):c.1187G>A (p.Gly396Asp) variant is classified as Uncertain significance - insufficient evidence for Familial Hypercholesterolemia by applying evidence code (PM2) as defined by the ClinGen Familial Hypercholesterolemia Expert Panel LDLR-specific variant curation guidelines (https://doi.org/10.1016/j.gim.2021.09.012). The supporting evidence is as follows: PM2: This variant is absent from gnomAD (gnomAD version 2.1.1). PP3/BP4 not met: REVEL=0.566, it is not above 0.75 but between 0.5-0.75, splicing evaluation required. Functional data on splicing is not available. In scenario A, acceptor site: The variant is located at -20 to +3 bases of canonical acceptor splicing site of exon 9. Wild type canonical acceptor motif: CTCGCTCCCCGGACCCCCAGGCT, MES: 6.59; Variant canonical acceptor motif: CTCGCTCCCCGGACCCCCAGACT, MES: 6.16. Var/Wt ratio = 0.93, greater than 0.8 and less than 1.0. Alternative splicing is not predicted. PS3 not met: Functional data not available. PP4, PS4 not met: Variant meets PM2, however clinical data is not available. PM5 not met: Three other missense variants in the same codon: NM_000527.5 (LDLR):c.1186G>A (p.Gly396Ser), (ClinVarID 251704), NM_000527.5 (LDLR):c.1187G>T (p.Gly396Val), (ClinVarID 924165), NM_000527.5 (LDLR):c.1186G>C (p.Gly396Arg), (ClinVarID 870321). None is classified as Pathogenic by these guidelines, therefore PM5 is not met.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Jan 13, 2025