NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) AND Myofibrillar myopathy, ZASP-related

Clinical significance:Uncertain significance (Last evaluated: Oct 15, 2020)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000474477.6

Allele description [Variation Report for NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])]

NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])

Gene:
LDB3:LIM domain binding 3 [Gene - OMIM - HGNC]
Variant type:
Microsatellite
Cytogenetic location:
10q23.2
Genomic location:
Preferred name:
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1])
HGVS:
  • NC_000010.11:g.86716391CCCTGCCCCTGCCTACACCCCCTC[1]
  • NG_008876.1:g.52828CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001080114.2:c.966CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001171610.2:c.1311CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001368064.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001368065.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_001368066.1:c.1155CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_007078.3:c.1296CCCTGCCCCTGCCTACACCCCCTC[1]MANE SELECT
  • NP_001073583.1:p.324APAYTPSP[1]
  • NP_001165081.1:p.439APAYTPSP[1]
  • NP_001354993.1:p.371APAYTPSP[1]
  • NP_001354994.1:p.371APAYTPSP[1]
  • NP_001354995.1:p.387APAYTPSP[1]
  • NP_009009.1:p.434APAYTPSP[1]
  • LRG_385t1:c.1320_1343del24
  • LRG_385:g.52828CCCTGCCCCTGCCTACACCCCCTC[1]
  • NC_000010.10:g.88476135_88476158del
  • NC_000010.10:g.88476148CCCTGCCCCTGCCTACACCCCCTC[1]
  • NM_007078.2:c.1320_1343del24
  • NM_007078.2:c.1320_1343delCCCTGCCCCTGCCTACACCCCCTC
  • c.1320_1343del
Links:
dbSNP: rs397517209
NCBI 1000 Genomes Browser:
rs397517209
Molecular consequence:
  • NM_001080114.2:c.966CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001171610.2:c.1311CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001368064.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001368065.1:c.1107CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001368066.1:c.1155CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_007078.3:c.1296CCCTGCCCCTGCCTACACCCCCTC[1] - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Name:
Myofibrillar myopathy, ZASP-related (MFM4)
Synonyms:
MYOPATHY, MYOFIBRILLAR, 4; Zaspopathy (type)
Identifiers:
MONDO: MONDO:0012277; MedGen: C4721886; OMIM: 609452

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000545676Invitaecriteria provided, single submitter
Uncertain significance
(Oct 15, 2020)
germlineclinical testing

PubMed (2)
[See all records that cite these PMIDs]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

The landscape of genetic variation in dilated cardiomyopathy as surveyed by clinical DNA sequencing.

Pugh TJ, Kelly MA, Gowrisankar S, Hynes E, Seidman MA, Baxter SM, Bowser M, Harrison B, Aaron D, Mahanta LM, Lakdawala NK, McDermott G, White ET, Rehm HL, Lebo M, Funke BH.

Genet Med. 2014 Aug;16(8):601-8. doi: 10.1038/gim.2013.204. Epub 2014 Feb 6.

PubMed [citation]
PMID:
24503780

Sherloc: a comprehensive refinement of the ACMG-AMP variant classification criteria.

Nykamp K, Anderson M, Powers M, Garcia J, Herrera B, Ho YY, Kobayashi Y, Patil N, Thusberg J, Westbrook M; Invitae Clinical Genomics Group., Topper S.

Genet Med. 2017 Oct;19(10):1105-1117. doi: 10.1038/gim.2017.37. Epub 2017 May 11. Erratum in: Genet Med. 2020 Jan;22(1):240-242.

PubMed [citation]
PMID:
28492532
PMCID:
PMC5632818

Details of each submission

From Invitae, SCV000545676.7

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (2)

Description

This sequence change deletes 24 nucleotides from exon 9 of the LDB3 mRNA (c.1320_1343del). This leads to the deletion of 8 amino acid residues in the LDB3 protein (p.Ala442_Pro449del) but otherwise preserves the integrity of the reading frame. The LDB3 gene has multiple clinically relevant transcripts. The p.Ala442_Pro449del variant occurs in alternate transcript NM_007078.2 which corresponds to c.*17041_*17064del in NM_001080116.1, the primary transcript listed in the Methods. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has been reported in an individual affected with dilated cardiomyopathy (PMID: 24503780). Clinvar contains an entry for this variant (Variation ID: 45514). Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Jul 7, 2021

Support Center