NM_181703.4(GJA5):c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3] AND Familial atrial fibrillation

Clinical significance:Likely benign (Last evaluated: Jun 14, 2016)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:

Allele description [Variation Report for NM_181703.4(GJA5):c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3]]


GJA5:gap junction protein alpha 5 [Gene - OMIM - HGNC]
Variant type:
Cytogenetic location:
Genomic location:
Preferred name:
  • NC_000001.11:g.147757496_147757520GGGCATTTGCCAGAGGTACATACCA[3]
  • NG_009369.2:g.20830_20854TGGTATGTACCTCTGGCAAATGCCC[3]
  • NM_005266.6:c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3]
dbSNP: rs11267274
NCBI 1000 Genomes Browser:
Molecular consequence:
  • NM_005266.6:c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3] - 3 prime UTR variant - [Sequence Ontology: SO:0001624]
  • NM_181703.4:c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3] - 3 prime UTR variant - [Sequence Ontology: SO:0001624]


Familial atrial fibrillation
MONDO: MONDO:0018054; MedGen: C3468561; Orphanet: 334; OMIM: PS608583

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
SCV000348109Illumina Clinical Services Laboratory,Illuminacriteria provided, single submitter
Likely benign
(Jun 14, 2016)
germlineclinical testing


Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Illumina Clinical Services Laboratory,Illumina, SCV000348109.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2021

Support Center