NM_000277.3(PAH):c.592_613del (p.Tyr198fs) AND not provided

Clinical significance:Pathogenic (Last evaluated: Nov 26, 2019)

Review status:(0/4) 0 stars out of maximum of 4 stars

no assertion criteria provided

Based on:
2 submissions [Details]
Record status:
current
Accession:
RCV000088995.2

Allele description [Variation Report for NM_000277.3(PAH):c.592_613del (p.Tyr198fs)]

NM_000277.3(PAH):c.592_613del (p.Tyr198fs)

Gene:
PAH:phenylalanine hydroxylase [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
12q23.2
Genomic location:
Preferred name:
NM_000277.3(PAH):c.592_613del (p.Tyr198fs)
HGVS:
  • NC_000012.12:g.102855231_102855252del
  • NG_008690.2:g.108161_108182del
  • NM_000277.1:c.592_613delTATAAAACCCATGCTTGCTATG
  • NM_000277.3:c.592_613delMANE SELECT
  • NM_001354304.2:c.592_613del
  • NP_000268.1:p.Tyr198fs
  • NP_001341233.1:p.Tyr198fs
  • NC_000012.11:g.103249007_103249028del
  • NC_000012.11:g.103249009_103249030del
  • NM_000277.1:c.592_613del
  • NM_000277.1:c.592_613del22
  • NM_000277.1:c.592_613delTATAAAACCCATGCTTGCTATG
Protein change:
Y198fs
Links:
dbSNP: rs199475697
NCBI 1000 Genomes Browser:
rs199475697
Molecular consequence:
  • NM_000277.3:c.592_613del - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001354304.2:c.592_613del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000119599DeBelle Laboratory for Biochemical Genetics, MUHC/MCH RESEARCH INSTITUTEno assertion providednot providednot providednot provided

SCV001823930GeneDxno assertion criteria provided
Pathogenic
(Nov 26, 2019)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing
not providednot providednot providednot providednot providednot provided1not providedliterature only

Details of each submission

From DeBelle Laboratory for Biochemical Genetics, MUHC/MCH RESEARCH INSTITUTE, SCV000119599.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providednot providednot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1not providednot provided1not providednot providednot providednot providednot providednot provided

From GeneDx, SCV001823930.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 21147011, 8069318, 19292873, 28676969, 24301756, 17096675, 26701937, 22572109, 10767174)

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 7, 2021

Support Center