NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup) AND Somatotroph adenoma

Clinical significance:Pathogenic (Last evaluated: Jun 21, 2012)

Review status:(0/4) 0 stars out of maximum of 4 stars

no assertion criteria provided

Based on:
1 submission [Details]
Record status:

Allele description [Variation Report for NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)]

NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)

AIP:aryl hydrocarbon receptor interacting protein [Gene - OMIM - HGNC]
Variant type:
Cytogenetic location:
Genomic location:
Preferred name:
NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)
  • NC_000011.10:g.67490805_67490825dup
  • NG_008969.1:g.12772_12792dup
  • NM_001302959.1:c.628_648dup
  • NM_001302960.2:c.797_817dup
  • NM_003977.4:c.805_825dupMANE SELECT
  • NP_001289888.1:p.Phe210_His216dup
  • NP_001289889.1:p.Leu266_Pro272dup
  • NP_003968.3:p.Phe269_His275dup
  • LRG_460t1:c.805_825dup
  • LRG_460:g.12772_12792dup
  • NC_000011.9:g.67258273_67258274insACTTCAAGCGGGGCAAGGCCC
  • NC_000011.9:g.67258276_67258296dup
  • NM_003977.2:c.805_825dupTTCAAGCGGGGCAAGGCCCAC
dbSNP: rs267606578
NCBI 1000 Genomes Browser:
Molecular consequence:
  • NM_001302959.1:c.628_648dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001302960.2:c.797_817dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_003977.4:c.805_825dup - inframe_insertion - [Sequence Ontology: SO:0001821]


Somatotroph adenoma (PITA1)
ISOLATED FAMILIAL SOMATOTROPINOMA; SOMATOTROPHINOMA, FAMILIAL; Pituitary tumor, growth hormone-secreting, somatic; See all synonyms [MedGen]
MONDO: MONDO:0007052; MedGen: C4538355; Orphanet: 963; OMIM: 102200

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
SCV000058037GeneReviewsno assertion criteria providedpathologic
(Jun 21, 2012)
not providedcuration

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providednot providednot providednot providednot providednot providednot providednot providedcuration

Details of each submission

From GeneReviews, SCV000058037.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedcurationnot provided


Converted during submission to Pathogenic.

OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1not providednot providednot providednot providedAssert pathogenicitynot providednot providednot providednot provided

Last Updated: Sep 29, 2021

Support Center