NM_000251.2(MSH2):c.1077-66_1146del AND Lynch syndrome

Clinical significance:Likely pathogenic (Last evaluated: Aug 18, 2011)

Review status:1 star out of maximum of 4 stars

criteria provided, single submitter

Based on:
1 submission [Details]
Record status:
current
Accession:
RCV000030236.1

Allele description [Variation Report for NM_000251.2(MSH2):c.1077-66_1146del]

NM_000251.2(MSH2):c.1077-66_1146del

Gene:
MSH2:mutS homolog 2 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
2p21
Genomic location:
Preferred name:
NM_000251.2(MSH2):c.1077-66_1146del
HGVS:
  • NC_000002.12:g.47429676_47429811del
  • NG_007110.2:g.31553_31688del
  • NM_000251.2:c.1077-66_1146del
  • NM_001258281.1:c.879-66_948del
  • LRG_218t1:c.1077-66_1146del
  • LRG_218:g.31553_31688del
  • NC_000002.11:g.47656815_47656950del
  • NM_000251.1:c.1077-69_1143del
  • NM_000251.2:c.1077-66_1146delGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTTCGT
Links:
dbSNP: rs193922372
NCBI 1000 Genomes Browser:
rs193922372
Molecular consequence:
  • NM_000251.2:c.1077-66_1146del - splice acceptor variant - [Sequence Ontology: SO:0001574]
  • NM_001258281.1:c.879-66_948del - splice acceptor variant - [Sequence Ontology: SO:0001574]
Observations:
1

Condition(s)

Name:
Lynch syndrome
Synonyms:
Familial nonpolyposis colon cancer
Identifiers:
MONDO: MONDO:0005835; MedGen: C4552100; OMIM: PS120435

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000052903Women's Health and Genetics/Laboratory Corporation of America, LabCorpcriteria provided, single submitter
likely pathogenic
(Aug 18, 2011)
germlinecuration, clinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknown1not providednot providednot providednot providedclinical testing
not providedgermlineyes1not providednot providednot providednot providedcuration

Details of each submission

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV000052903.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedcurationnot provided
2not providednot providednot providednot providedclinical testingnot provided

Description

Converted during submission to Likely pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providedBloodassert pathogenicitynot providednot providednot providednot provided
2germlineunknownnot providedBloodassert pathogenicitynot providednot providednot provided See 2

Co-occurrences

#ZygosityAllelesNumber of Observations
2HomozygoteMLH1:c.1668-19A>G, MSH2:c.211+9C>G, MSH2:c.1661+12G>A, MSH2:c.1077-80G>A, MSH6:c.540T>C, MSH6:c.276A>G, MSH6:c.186C>A, MSH6:c.3438+14A>T1

Last Updated: Jun 14, 2021

Support Center