NM_014251.3(SLC25A13):c.1638_1660dup (p.Ala554fs) AND Citrullinemia type II

Germline classification:: Pathogenic (2 submissions)
Last evaluated:: Feb 24, 2023
Review status:: 1 star out of maximum of 4 stars
criteria provided, single submitter

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000006371.9

Allele description [Variation Report for NM_014251.3(SLC25A13):c.1638_1660dup (p.Ala554fs)]

NM_014251.3(SLC25A13):c.1638_1660dup (p.Ala554fs)

Gene:

SLC25A13:solute carrier family 25 member 13 [Gene - OMIM - HGNC]

Variant type:

Duplication

Cytogenetic location:

7q21.3

Genomic location:

Preferred name:

NM_014251.3(SLC25A13):c.1638_1660dup (p.Ala554fs)

Other names:

1638ins23; p.Ala554Glyfs*17

HGVS:

NC_000007.13:g.95751240_95751241insCCCGGGCAGCCACCTGTAATCTC
NC_000007.14:g.96121929_96121951dup
NG_012247.2:g.205197_205219dup
NM_001160210.2:c.1641_1663dup
NM_014251.3:c.1638_1660dupMANE SELECT
NP_001153682.1:p.Ala555fs
NP_055066.1:p.Ala554fs
NC_000007.13:g.95751240_95751241insCCCGGGCAGCCACCTGTAATCTC
NC_000007.13:g.95751241_95751263dup
NC_000007.13:g.95751241_95751263dupCCCGGGCAGCCACCTGTAATCTC
NM_014251.2:c.1638_1660dup23
NM_014251.3:c.1638_1660dup
NR_027662.2:n.1664_1686dup

Protein change:

A554fs

Links:

OMIM: 603859.0003; dbSNP: rs80338725

NCBI 1000 Genomes Browser:

rs80338725

Molecular consequence:

NM_001160210.2:c.1641_1663dup - frameshift variant - [Sequence Ontology: SO:0001589]
NM_014251.3:c.1638_1660dup - frameshift variant - [Sequence Ontology: SO:0001589]
NR_027662.2:n.1664_1686dup - non-coding transcript variant - [Sequence Ontology: SO:0001619]

Condition(s)

Name:: Citrullinemia type II
Identifiers:: MONDO: MONDO:0016603; MedGen: C1863844

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000026553	OMIM	no assertion criteria provided	Pathogenic (Jun 1, 1999)	germline	literature only	PubMed (1) [See all records that cite this PMID]
SCV003845174	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	criteria provided, single submitter (LabCorp Variant Classification Summary - May 2015)	Pathogenic (Feb 24, 2023)	germline	clinical testing	PubMed (2) [See all records that cite these PMIDs] 31450232, 21424115 Citation Link

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000026553

OMIM

no assertion criteria provided

Pathogenic
(Jun 1, 1999)

germline

literature only

PubMed (1)
[See all records that cite this PMID]

SCV003845174

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

criteria provided, single submitter

(LabCorp Variant Classification Summary - May 2015)

Pathogenic
(Feb 24, 2023)

germline

clinical testing

PubMed (2)
[See all records that cite these PMIDs]

Citation Link

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	not provided	not provided	not provided	not provided	not provided	not provided	literature only
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

The gene mutated in adult-onset type II citrullinaemia encodes a putative mitochondrial carrier protein.

Kobayashi K, Sinasac DS, Iijima M, Boright AP, Begum L, Lee JR, Yasuda T, Ikeda S, Hirano R, Terazono H, Crackower MA, Kondo I, Tsui LC, Scherer SW, Saheki T.

Nat Genet. 1999 Jun;22(2):159-63.

PubMed [citation]

PMID:: 10369257

Molecular findings in children with inherited intrahepatic cholestasis.

Wang NL, Lu Y, Gong JY, Xie XB, Lin J, Abuduxikuer K, Zhang MH, Wang JS.

Pediatr Res. 2020 Jan;87(1):112-117. doi: 10.1038/s41390-019-0548-8. Epub 2019 Aug 26.

PubMed [citation]

PMID:: 31450232

See all PubMed Citations (3)

Details of each submission

From OMIM, SCV000026553.3

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	literature only	PubMed (1)

Description

In a patient with adult-onset citrin deficiency (CDAA; 603471), Kobayashi et al. (1999) identified a 23-bp homozygous insertion (c.1638ins23) in exon 16 of the SLC25A13 gene, resulting in a frameshift at codon 554 and the addition of 16 new amino acids. A stop codon was introduced at position 570, leading to premature termination of the C terminus of citrin. The inserted sequence was apparently a tandem repeat of 23 bp from nucleotide 1638-1660 of SLC25A13 cDNA.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	not provided	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV003845174.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (2)

Description

Variant summary: SLC25A13 c.1638_1660dup23 (p.Ala554GlyfsX17) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic within ClinVar (e.g. c.1799dup [p.Tyr600Ter], c.1813C>T [p.Arg605Ter]). The variant allele was found at a frequency of 8.8e-05 in 251412 control chromosomes (gnomAD), predominantly at a frequency of 0.0012 within the East Asian subpopulation in the gnomAD database. This frequency is not significantly higher than estimated for a pathogenic variant in SLC25A13 causing Citrullinemia Type II (8.8e-05 vs 0.0012), allowing no conclusion about variant significance. c.1638_1660dup23 has been reported in the literature as a biallelic genotype in multiple individuals affected with Citrullinemia (e.g. Song_2011, Wang_2020). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Four ClinVar submitters have assessed the variant since 2014: all four classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: May 16, 2025

ClinVar

Relating variation to medicine