NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] AND Usher syndrome, type 1C

Clinical significance:Conflicting interpretations of pathogenicity, Benign(1);Pathogenic(1) (Last evaluated: Jun 20, 2013)

Review status:(0/4) 0 stars out of maximum of 4 stars

no assertion criteria provided

Based on:
2 submissions [Details]
Record status:
current
Accession:
RCV000005449.8

Allele description [Variation Report for NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]]

NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]

Gene:
USH1C:USH1 protein network component harmonin [Gene - OMIM - HGNC]
Variant type:
Microsatellite
Cytogenetic location:
11p15.1
Genomic location:
Preferred name:
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]
Other names:
USH1C, VNTR EXP
HGVS:
  • NC_000011.10:g.17527120CCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTC[9]
  • NG_011883.2:g.22215GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]
  • NM_001297764.2:c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]
  • NM_005709.4:c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]
  • NM_153676.4:c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9]MANE SELECT
  • NC_000011.9:g.17548737delinsCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTCATGGAGTACTGCCCTGCTCCCCCGCCCTCCCTCCCTCCCACCGTC
  • NG_011883.1:g.22253_22342GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2]
  • NM_153676.3:c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2]
  • NM_005709.3:c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2]
Links:
OMIM: 605242.0003; dbSNP: rs55983148
NCBI 1000 Genomes Browser:
rs55983148
Molecular consequence:
  • NM_001297764.2:c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] - intron variant - [Sequence Ontology: SO:0001627]
  • NM_005709.4:c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] - intron variant - [Sequence Ontology: SO:0001627]
  • NM_153676.4:c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Name:
Usher syndrome, type 1C (USH1C)
Synonyms:
USHER SYNDROME, TYPE I, ACADIAN VARIETY; Usher syndrome, Acadian variety
Identifiers:
MONDO: MONDO:0010171; MedGen: C1848604; Orphanet: 231169; Orphanet: 886; OMIM: 276904

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000025631OMIMno assertion criteria providedPathogenic
(Jan 1, 2002)
germlineliterature only

PubMed (2)
[See all records that cite these PMIDs]

SCV000086933GeneReviewsno assertion criteria providednon-pathogenic
(Jun 20, 2013)
not providedcuration

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlinenot providednot providednot providednot providednot providednot providedliterature only
not providednot providednot providednot providednot providednot providednot providednot providedcuration

Citations

PubMed

A defect in harmonin, a PDZ domain-containing protein expressed in the inner ear sensory hair cells, underlies Usher syndrome type 1C.

Verpy E, Leibovici M, Zwaenepoel I, Liu XZ, Gal A, Salem N, Mansour A, Blanchard S, Kobayashi I, Keats BJ, Slim R, Petit C.

Nat Genet. 2000 Sep;26(1):51-5.

PubMed [citation]
PMID:
10973247

The USH1C 216G-->A mutation and the 9-repeat VNTR(t,t) allele are in complete linkage disequilibrium in the Acadian population.

Savas S, Frischhertz B, Pelias MZ, Batzer MA, Deininger PL, Keats BB.

Hum Genet. 2002 Jan;110(1):95-7. Epub 2001 Dec 6.

PubMed [citation]
PMID:
11810303

Details of each submission

From OMIM, SCV000025631.3

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedliterature only PubMed (2)

Description

In Louisiana-Acadian patients with Usher syndrome type IC (276904), Verpy et al. (2000) found no mutation in the coding sequence of the harmonin gene; however, they detected an expansion of a variable number of tandem repeats (VNTR) of a 45-bp element in intron 5 of the USH1C gene. They detected no control individuals with 2 alleles bearing more than 6 repeats. In all but 1 of 11 Acadian patients, they found an allele with 9 tandem repeats in the homozygous state. These 10 individuals were from 7 families. The remaining Acadian patient carried the 9 tandem repeats on 1 chromosome and the 238_239insC mutation (605242.0002) on the other. Verpy et al. (2000) proposed that this 405-bp intronic sequence composed of 9 tandem repeats was responsible for the disease in the Acadian population of Louisiana. The repeat expansion was predicted to inhibit transcription, as shown for the expanded GAA triplet repeats from intron 1 of the Friedreich ataxia gene (229300). Alternatively, it may cause abnormal posttranscriptional processing.

Savas et al. (2002) found that 43 of 44 Acadian patients with Usher syndrome were homozygous for both a 216G-A mutation (605242.0004) and the 45-bp VNTR polymorphism in the USH1C gene. The remaining Acadian patient was a compound heterozygote for the 216G-A allele (with the intron 5 VNTR in cis) and 238_239insC (605242.0002), an USH1C mutation found in other populations. The findings demonstrated that the VNTR polymorphism, designated 9VNTR(t,t), had complete linkage disequilibrium with the 216G-A mutation in the Acadian population.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlinenot providednot providednot providednot providednot providednot providednot providednot provided

From GeneReviews, SCV000086933.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedcurationnot provided

Description

Converted during submission to Benign.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1not providednot providednot providednot providedAssert pathogenicitynot providednot providednot providednot provided

Last Updated: Oct 8, 2021

Support Center