CodeGenderBirthdayCountryCode SampleBody OrganCollection DateCode SequenceGenomic RegionDNA Sequence
0001M01/01/1970Brazil001Liver10/10/20051111ENV'atgcctgacttgctacccttggaaatcga
0001M01/01/1970Brazil001Liver10/10/20051112POTatgcctgacttgctacccttggaaacttaaa'
0001M01/01/1970Brazil001Liver10/10/20051113nullaaatcga...tactttactttaccataacttaaa'
0001M01/01/1970Brazil002spleen05/05/20052222nullaccataacttaaa accataacttaaa
0001M01/01/1970Brazil002spleen05/05/20052223POTtacttactttactttttactttaccataacttaaa
0001M01/01/1970Brazil002spleen05/05/20052223POTtacttactttactttttactttaccataacttaaa
2040F02/02/1980Angola005lung02/02/20063333ENV'atgcctgacta...tactttactttaccataacttaaa
2040F02/02/1980Angola005lung02/02/20063334Nullaaatcga...tactttactttaccataacttaaa'

From: Chapter A02, Understanding Database Design

Cover of Bioinformatics in Tropical Disease Research
Bioinformatics in Tropical Disease Research: A Practical and Case-Study Approach [Internet].
Gruber A, Durham AM, Huynh C, et al., editors.

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.