NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.

Madame Curie Bioscience Database [Internet]. Austin (TX): Landes Bioscience; 2000-2013.

Cover of Madame Curie Bioscience Database

Madame Curie Bioscience Database [Internet].

Show details

Gene Therapy-Based Approach for Immune Tolerance Induction Using Recombinant Immunoglobulin Carriers

, , , and .

Introduction

The mechanisms of tolerance induction and its breakdown are important to explore because of its involvement in the pathogenesis of many known autoimmune diseases. Tolerance to “self ” is not absolute and can be overcome by the immune system after a foreign stimuli caused by pathogens, allergens or other unknown immune errors (e.g., defects in apoptosis) that affect the immune system, causing a switch from tolerance to an immune response. Therefore, autoimmune diseases may often result from an aberrant or dysfunctional immune response that can no longer discriminate between “self ” and “non self ” proteins. This deregulation will eventually lead to a systemic disease manifested by organ or tissue specific disorder and pathogenesis. Reversal of this breakdown by the re-introduction of tolerance is therefore an important goal.

Laboratories around the globe have tried to use different gene therapy based approaches to modulate the immune response. By definition, gene therapy is based on the introduction of a DNA fragment, expressing a gene or part of a gene, into a host cell in order to reverse, replace, amplify or correct its function. For example, cytokines, receptors or inhibitors have been used by gene therapy to shift the immune response from a TH1 to a TH2 response1-3 or vice-versa depending on the immune model. Replacement of genes involved in cell death has been used to trigger apoptosis in inflammatory joints of animal models. Immunomodulators such as CTLA-4 fused to an immunoglobulin to increase its half-life have been used in several gene therapy protocols to down regulate the manifestation of autoimmunity in animal models.4, 5 Our lab, for example, has employed retroviral gene transfer into B cells of an immunoglobulin construct carrying major immunodominant peptides or full-length antigens to re-educate the immune system into tolerance induction.6-11

Like many other approaches, gene therapy has its own drawbacks that can only be minimized with continuous experimentation and our knowledge of the immune system and molecular biology techniques. One major problem of gene therapy is the vehicle of delivery. Most laboratories use attenuated viruses (Adeno-, retro-, lentiviruses etc.) as tools for delivery of the targeted genetic material. These obviously may incur adverse effects in humans because of their immunogenicity, problems with retroviral insertions and recombination concerns. Thus, they can complicate other health related issues that makes this avenue difficult to employ and gain acceptance by the public in coming years. Another method of gene delivery is “naked DNA” injection. This simple technique is based on the injection of the genetic material without any vehicle of transportation. Scientists rely on the simple principle of endocytosis and DNA delivery to the nucleus through processing cytoplasmic protein carriers. The problem in this approach is the low efficiency of transfer and the triggering of non-specific immune responses due to CpG sequences present in most vectors that can prevent the host cells from expressing the gene. Finally, the use of liposomes is another way of introducing new genes into a host. This technique takes advantage of the lipid bilayer fusion by encapsulating the DNA in a lipid micelle that protects it from phagocytes and insures its safe delivery to the cytoplasm. Different labs have varying levels of success using this approach; perhaps due to the limited knowledge we have about the mechanisms, molecules and lipids involved in this process. In our opinion, this is still a very promising approach that needs to be explored further because of its safety and efficiency in delivery.

In this chapter we will explore the history of the hapten—carrier theory that led to the discovery of the Ig-peptide carriers as mediators of immune tolerance in animal models. Based on the authors' work and in order to understand the principle of tolerogenicity by this system, B-cell antigen presentation and Ig-peptide mechanisms will be revisited. We will re-evaluate published data showing that this gene therapy approach is efficacious in three autoimmune models, which can be adjusted for future clinical trials in human subjects.

Hapten-Carriers in the History of Tolerance

Our laboratory has been studying the effect of immunoglobulin carriers on tolerance induction based on the previous work of several labs, including those of Weigle, Borel and Scott.12-15 Their work on this subject showed that the use of carriers such as gamma globulins could induce tolerance in host animals. But there were some differences on the fate of B cells among groups. The studies generated by Venkataraman and Scott and their colleagues, showed persistence of the unresponsive (anergic) cells in the spleen by the usage of fluorescein (FITC)-tagged gamma globulin. Those cells disappeared from the spleen in few days if the mice were not challenged with the tolerogen. In mice rechallenged with the tolerogen, antigen-binding cells (ABC) re-appeared in the spleen. Later studies determined those tolerant cells as being B cells that were anergic and cell cycle arrested. On the other hand, Borel and Aldo-Benson's work using a similar system in which DNP was coupled to an isologous murine IgG, showed that unresponsiveness in host animals as well as ABC persisted in the periphery for several weeks. The main difference between the two groups was the use of heterologous IgG in Scott's group versus an isologous IgG in Borel's group. This difference enhanced the hypothesis that carriers play a role in modulating the immune response. Further efforts to elucidate the mechanisms of tolerance induction by hapten-carriers did not progress until the emergence of recombinant DNA technologies.

In 1996, Zambidis et al7 created transgenic mice that expressed and secreted an IgG1 fusion protein containing a peptide, p12-26 of the bacteriophage λ cI repressor protein at its N-terminus. This is a full-length immunoglobulin with its heavy chain and Fc portion, unlike fusion protein such as Ig-CTLA-4 or Ig-IL-4 that has only the Fc portion of the protein to enhance the half-life of the carried gene. The p12-26 peptide was chosen for this construct because it contained both a B cell and T cell epitope from the λ cI repressor protein domain, p1-102. This protein was well characterized and the immunodominant epitopes were well known in different strains of mice with different MHC class II haplotypes. The peptide p12-26 is the major immunodominant epitope in H-2d mice, whereas H-2b mice recognize a more C-terminal peptide, p73-88. Studies on the p12-26-IgG transgenic mice showed high levels of serum peptide IgG fusion protein. These transgenic mice showed extensive unresponsiveness to a challenge with p12-26 or even p1-102. Moreover, Balb/c mice adoptively transferred with transgenic resting or even LPS blasted B cells or bone marrow cells were also rendered unresponsive to challenge with p12-26. Tolerance could even be transferred with less than 100,000 purified B cells! Together with recombinant DNA technologies, this tolerance induction to p12-26 peptide opened the door for extensive studies to understand the nature of this response.

Further studies by Zaghouani's labs16 utilized IgG carriers engineered to contain immunodominant epitopes involved in Experimental Autoimmune Encephalomyelitis (EAE). This group demonstrated that their IgG chimeras carrying an encephalitogenic proteolipid peptide 139-151 (Ig-PLP 139-151) induced neonatal tolerance to EAE. Although their system requires neonatal delivery of the carrier, the end result is always suppression of the immune reaction against the specific antigen and reversal of the adverse immune response. While mechanism of action in this system is not clear, it involves cytokine modulation in the lymph node and spleen for tolerance induction.16

Gene Transfer of IgG-Peptides

Following the success of the transgenic mice in inducing tolerance, many questions emerged about the nature of this tolerance induction. Clearly in transgenic mice, we cannot distinguish between the induction of neonatal tolerance, meaning that during neonatal development the immune system learned not to attack the fusion protein (i.e., p12-26-IgG) and the maintenance of peripheral tolerance in adults. One method by which this question could be answered is through the emerging gene therapy techniques using replication deficient viruses and transfer into immunocompetent adults. The obvious choice of Zambidis et al8 were retroviruses, due to their nature of infection (i.e., infecting only dividing cells), their low immunogenicity in mice and their ease of use. A retroviral vector based on Hozumi's retroviral vector used to infect stem cells17 was engineered (fig.1) to contain viral LTR promoters,a β-Actin promoter to control the transcription of the inserted gene and the murine IgG1 heavy chain in which peptides and antigens will be inserted. The idea of transferring only the heavy chain was to take advantage of the assembly machinery of B cells, which will provide the light chains needed to assemble the molecule and produce a complete immunoglobulin with a peptide on its N-terminus. To establish immune tolerance that mimics the transgenic mice described above, initially bone marrow from adult mice were cultured ex vivo for two days with the engineered retrovirus and cytokines, and then adoptively transferred to sub-lethally irradiated mice. Continuous serum level of the fusion protein was monitored using NIP-binding ELISAs since the IgG heavy chain had high affinity for that hapten. Two months later, when the immune system had recovered, those mice were challenged with p12-26 and p1-102 and shown to be unresponsive to both at cellular and humoral levels. RT-PCRs were performed to demonstrate the persistence of the gene in the spleen and marrow of tolerant (versus control) mice. This experiment proved that the transgenic model was valid but also convinced the group to pursue gene therapy as a better approach to understand tolerance induction by IgG-peptides. Subsequently, experiments were successfully performed using infected and LPS-activated B cells that showed tolerance induction in host mice. This latter experiment showed the potential of using this approach in a clinical setting using drawn blood from affected patients to which an autoantigen will be transferred on the tip of the IgG to re-educate the immune system and induce tolerance to several autoimmune diseases, such as juvenile diabetes, uveitis, multiple sclerosis and possibly others such as lupus or rheumatoid arthritis (cf. 10, 11). In order to achieve this goal, an elucidation of the mechanisms of action behind this tolerance induction was needed.

Figure 1. MBAE retroviral construct used for tolerance studies.

Figure 1

MBAE retroviral construct used for tolerance studies. The vector is engineered with a murine IgG1 heavy chain cassette designed to carry a variety of antigens and peptides on its N terminus. The gene is driven by a β-Actin promoter. The retrovirus (more...)

Following those experiments, several questions arose, such as: which is more important to achieve tolerance, secretion or presentation of the IgG-peptide? Are B cells required to present or can any other APC lead to tolerance? What is the role of suppressive cytokines, such as IL-10? Does this tolerance follow the classic signal 1 — signal 2 activation model? If yes, is CTLA-4 involved or not? Can this system induce tolerance to primed animals, which would mimic an autoimmune patient with elevated titers of anti-self antibodies or primed T-cell clones? What are the roles of Fc receptors and the requirement for the Fc portion of the immunoglobulin in the construct? Can different modulators or activators of the immune system such as CD40, Flt3L or CpG sequences be used to activate the B cells and affect the outcome of tolerance? Finally, can this model be applied on animal models of known human autoimmune diseases?

Mechanism of Action

Role of the IgG Carrier, Fc Receptors, and MHC Class II in Tolerance

To answer the questions mentioned in the previous paragraph, experiments using different animal models lacking or over-expressing some key genes were used. In 1998, our colleague Yubin Kang studied the impact of the immunoglobulin carrier on tolerance induction by infecting bone marrow or activated B cells with vectors for p1-102-IgG or p1-102 alone.9 Cytokine secretion measured after an in vitro stimulation of splenocytes and lymph node lymphocytes showed a more significant decrease in TH1 and TH2 T cell activities versus the group receiving p1-102 alone, although tolerance did not require the IgG. Thus, while the IgG carrier was not necessary for the induction of tolerance, its presence led to more significant unresponsiveness. Importantly, upon challenge for a secondary response, they found that tolerance was lost with p1-102 alone but persisted with the IgG carrier. It is notable also that the gene persisted in the spleens of host mice for several months after the transfer with both constructs. Thus, they drew the conclusion that IgG1 as a carrier was necessary for the long-term maintenance of hyporesponsiveness in host mice at both the cellular and humoral levels.

In light of this study, we (El-Amine et al) studied the role of the Fc portion on tolerance induced by IgG-peptide constructs.18 To do this, we used different FcR KO mice both as hosts and as donors of the infected B cells. Thus, we found that the presence of FcR was not required for tolerance in this model as the same degree of unresponsiveness was found with FcR negative B cells used either for donor B cells or for both donor and recipients. Thus, although the IgG appeared important in tolerance, FcR do not appear to be involved in this model of tolerance. To formally exclude the Fc portion of the IgG carrier, we also mutated the IgG1 in the p12-26-IgG construct in position 297 of the Fc region of the heavy chain; this residue controls the ability of IgG to bind to Fc receptors, but also to fix complement and transit tissues.19 This did not affect the tolerogenicity of the construct. Therefore, both FcR and the biologic function of the Fc portion of the immunoglobulin carrier do not appear to be required for the induction of tolerance. Finally, the injection of anti-FcR antibodies (2.4G2) into host mice that received activated splenocytes from the transgenic mice did not affect tolerance induction. This study also suggests that secretion of the IgG carrier and its uptake by the FcR, for possible presentation by MHC class II molecules, is not the major route for IgG-peptide mediated tolerance. These results show that while neither the Fc nor the FcR are involved in this tolerance, they could be important in the persistence of the tolerance.

The authors also studied the effect of presentation on tolerance induction to compare it with the secretion-uptake hypothesis. In their studies, this group aimed to understand the importance of B cells as antigen presenting cells (APC) in the process of endogenous uptake and presentation on their MHCs of different epitopes of the IgG-carrier molecule. This mode of presentation would then lead to a tolerogenic signal delivered by B cells to specific T cells. In principle, tolerogenic epitopes could then re-educate the immune system to down regulate its response against an autoimmune antigen. To test this hypothesis, we used MHC class II KO mice as donors of bone marrow or B cells. We infected them with the retrovirus containing the IgG-peptide construct and injected them into syngeneic class II positive mice. In this model, B cells transferred with gene will lack the capability of presenting the epitopes encoded therein. Since secretion appears to be a minor route for tolerance induction, an immune response to the peptide in the recipients of MHC class II KO B cells would indicate a major requirement of MHC class II on presenting B cells in this model of tolerance induction. Upon challenge, the immune responses at cellular and humoral levels showed that tolerance was not induced unless class II positive cells were used to present the targeted epitopes.20 While it is still possible that local uptake of a secreted IgG fusion protein may occur (and the B cells making it would have a selective advantage), class II is necessary on the presenting cells and cross-presentation by host B cells is not involved.

The Scott lab previously used SCID mice as bone marrow donors to test the role of B cells in our gene therapy model, and found tolerance in terms of the primary response.8 However, since SCID mice (especially older donors) can be “leaky”, this hypothesis was re-investigated using B—cell knockout mice (μMT),20 which we have backcrossed to H-2d. These studies made using μMT (B cell KO) bone marrow infected with the retrovirus demonstrated that B cells were indeed required for tolerance. Thus, these mice have other potential antigen-presenting cells (such as dendritic cells), but lack B cells as APCs. The lack of tolerance in the treated group proved the need for B cells to process and present epitopes and induce tolerance. These experiments shed light on the importance of presentation in this model rather than secretion and uptake (fig.2). These results suggest that B-cell tolerogenic antigen presentation seems to be the dominant pathway in our model.

Figure 2. Mechanism of tolerance induction by an IgG-peptide.

Figure 2

Mechanism of tolerance induction by an IgG-peptide.

Role of Co-Stimulation and the Mode of B-Cell Activation

Importantly, transfection of B cells requires their stimulation by mitogens in order to infect with retrovirus. In the past, we have used LPS and CD40L to stimulate our B cells with similar results. Since stimulation with LPS, e.g., upregulates B7.1 and B7.2 on B cells, this effectively eliminated lack of costimulation as a factor in the induction of tolerance by B cells. To examine the influence of different B-cell activators on IgG-peptide-induced tolerance, we stimulated BALB/c spleen cells with CD40L, CpG21 oligonucleotides (active or inactive) or LPS. After 24hr, flow cytometry analysis of MHC class II and B220 expression showed a hierarchy of “activation” with CpG>CD40L>LPS (fig.3A). When these cells were then infected with retroviral vectors expressing the p12-26-IgG fusion proteins via our standard protocol, we found that both LPS and CD40L-activated B cells were tolerogenic, but that CpG activated B cells were not, in terms of proliferation (fig.3B), as well as IL-2 and IL-4 cytokine responses. We propose that this explains the utility of naked DNA vaccines for immunization because CpG sequences primed the mouse and acted as an adjuvant. Current data suggest that B7-family members are expressed on activated B cells at similar levels at 48 hrs; recent studies (Litzinger and Scott, in preparation, see Table 1) show that B7 expression is maintained for up to one week in vivo on LPS-activated B cells, but that these cells more quickly revert to a resting phenotype with CpG activation.

Figure 3. CpG oligomers promote survival and enhances activation of B cells.

Figure 3

CpG oligomers promote survival and enhances activation of B cells. Splenocytes were stimulated for 24hrs with 30μg/ml of LPS, 60μg/ml of CpG (ATCGACTCTCGAGCGTTCTC) and 10μg/ml of CD40L. (A) Cells were stained for B220 and I-Ad (more...)

Table 1. Expression of B7.2 by Stimulated B Cells in Vivo*.

Table 1

Expression of B7.2 by Stimulated B Cells in Vivo*.

To further analyze the role of the B cell in this gene therapy protocol, retrovirally transduced B cells were labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE) in order to track the proliferation, persistence, and phenotype of tolerogenic B cells in vivo, as well as to evaluate the effect of different stimuli on these tolerogenic B cells. We found that CFSE-labeled, retrovirally-transduced B cell blasts persisted in spleen for at least a month. By 7 days following transfer, more than 75 percent of the B-cell antigen-presenting cells have divided. The fate and phenotype of LPS vs. CpG stimulated transduced B cells are currently being further clarified.

We further tested the role of co-stimulation by treating recipients with anti-CTLA-4 to block the negative regulation by this receptor interacting with B722,23 on the tolerogenic APC. Our results20 suggest that blocking CTLA-4 interactions interferes with tolerance induction but only in primed hosts presumably because CTLA-4 is upregulated on primed but not naïve T cells;23 in addition, anti-CTLA-4 may permit protective CD28:B7 interactions to occur. Since tolerance is relatively long-lived, this suggests that in vivo maintenance of tolerance probably occurs via a lack of co-stimulation but initially may require CTLA-4:B7 interactions based on the effects of anti-CTLA-4 treatment.

Knowing the importance of dendritic cells (DC) in immune tolerance and since the CpG treatment of B cells increases CD11c+ cells we decided to investigate their role in our system. Therefore, we injected p12-26-IgG transduced BM cells into syngeneic irradiated recipients and then began a 10-day treatment with hFlt3L to enhance DC development. It's well known that Flt3L treatment induces the development of CD11c+/CD11b+ DC,24,25 which modulate different immune responses in different systems. Following the 10-day treatment, we observed both splenomegaly and an increase in CD11c, CD11b positive cells in bone marrow and spleen. Six weeks later when immune competence had been restored, BM chimeras were immunized and results showed that recipients of retrovirally transduced BM cells were not tolerant at the T-cell level when treated with Flt3L (fig.4). Presumably this is due to increased presentation by marrow-derived dendritic cells. While these data do not prove that DCs are immunogenic APCs in our system, it suggests that Flt3L treatment obviates the tolerogenicity of transduced B-cell precursors in the marrow. We still need directly test whether DC can be tolerogenic by transducing normal marrow cells and then differentiating them under DC or B-cell promoting conditions in vitro.

Figure 4. Recipients of retrovirally transduced bone marrow chimeras treated with Flt3L are not tolerant to p12-26.

Figure 4

Recipients of retrovirally transduced bone marrow chimeras treated with Flt3L are not tolerant to p12-26. (A) Spleen cells and Bone Marrow were stained for surface expression of CD11b and CD11c positive cells before and after injection with Flt3L. (B) (more...)

Recently, Zaghouani and co-workers26 also reported that tolerance induced by peptide IgG conjugates may be optimized by aggregation of the IgG and the induction of IL-10 synthesis by activated T cells. While there are many differences between their system and ours (IgG2 vs. IgG1 carrier; neonatal vs. adult treatment; aggregated antigen is often immunogenic), the observation that IL10 is a powerful suppressor to TH1 responses led us to test a possible role of this cytokine in gene-transferred tolerance. Therefore, we used IL10 knockout (IL10-/-) mice as recipients of gene transferred bone marrow cells or bone marrow from IL10-/- or control mice. Our results show that IL-10 is not required for tolerance induction, nor is TH1/ TH2 skewing involved.20

In further experiments, in collaboration with Drs. Rajeev Agarwal and Rachel Caspi, we were unable to demonstrate a role for active suppression in gene-transferred tolerance since T-cells enriched from tolerant mice failed to transfer hyporesponsiveness.27 However, these experiments need to be repeated, for example, with enrichment of CD25+ T cells with potential for suppressive activity, especially due to recent results in a diabetes model (see below).

Additional studies used gld B cells as a source of tolerogenic APC (in normal recipients which are not deficient in the Fas-FasL system). This was based on our finding that FasL was upregulated on LPS blasts. Our results initially suggested that cells lacking functional FasL (gld) were less effective as tolerogenic APC. While this result suggests the hypothesis that activation-induced cell death may be a major pathway of gene transferred tolerance, recent data from the Caspi lab demonstrated that gld B cells could be tolerogenic in a model of uveitis. Therefore, this area needs further investigation.

Applications for Clinical Models of Autoimmune Diseases

An important goal of our group has been to develop technology that can be applied for autoimmune diseases. As a first model, our lab collaborated with the Caspi lab at the National Eye Institute to examine this retroviral gene therapy approach for tolerance to an uveitogenic peptide (residues 161-180) from the interreceptor retinal binding protein27 (IRBP). When this peptide coding sequence was inserted in frame in the IgG cassette and used as above, highly significant tolerance was achieved and dramatic diminution of disease was evident. This tolerogenic effect was stable for over six months! Importantly, with multiple injections of p161-180-IgG-transduced B-cell blasts, uveitis initiated by primed T cells could be reversed. More recent data also suggest that gene therapy with this immunodominant peptide construct could protect against challenge with the full-length IRBP protein (Caspi and Agarwal, personal communication).

In the EAE model, we engineered myelin basic protein (MBP)-IgG retroviral constructs to examine tolerance to encephalitogenic epitopes. Using a full-length MBP-IgG retroviral vector, we were able to reverse the transfer of EAE in different mice which have the potential to recognize different epitopes on MBP. Hence, to achieve clinical efficacy, one does not need to know the precise peptide sequences that bind to the appropriate MHC of the patient, unlike other procedures (such as specific peptide analogs), which require precise knowledge of the specific immunodominant class II epitope. Moreover, this protocol should work with different class II backgrounds, and other encephalitogenic proteins, like MOG and PLP, which is currently under study in the Scott lab. We have now extended these studies to treatment after disease symptoms have appeared (Melo and Scott, unpublished; see fig.5) and using B cells from MBP primed donors.

Figure 5. Effect of gene therapy with MBP-IgG retrovirally transduced primed B cells on ongoing EAE.

Figure 5

Effect of gene therapy with MBP-IgG retrovirally transduced primed B cells on ongoing EAE. Primed T cells from mice immunized with MBP in CFA were cultured with MBP + IL-2 and then used for passive transfer of disease to syngeneic recipients, which were (more...)

This system has now been extended to a spontaneous murine model for diabetes. Thus, we created full-length glutamic acid decarboxylase (GAD65)-IgG constructs and tested their efficacy in NOD mice, which spontaneously develop diabetes. In experiments, with a single treatment at 7-10 weeks (prior to overt clinical disease but with peri-insulitis) with this vector, we found a significant delay in the onset of diabetes, as measured by glucose levels and prolongation of life. In addition, a single treatment with either B cell transfected with GAD-IgG or with a second construct, insulin B9-23-IgG, after clinical signs of diabetes (week 14) showed less efficacy, although GAD was slightly better than the insulin B chain epitope.28

Because the islets are being destroyed by diabetogenic T cells once clinical symptoms appear, we wanted to test whether we could induce tolerance in primed T cells in animals with intact islets. Therefore, we transferred T cells from diabetic female mice to either NOD-scid (lacking an immune system) or NOD males, which have a low incidence of disease. We were unable to prevent diabetes in NOD-scid recipients, initially a disappointing result (Soukhareva and Scott, in preparation). However, complete prevention of the transfer of diabetes to male recipients occurred with GAD-IgG infected NOD B cells. These data show that clinical efficacy can be achieved with primed T cells and moreover that some host element, perhaps a regulatory T cell, might be involved in tolerance. Further studies in this system are in progress.

These results are highly encouraging as these not only provide proof of principle in several clinical disease models, but also support our hypothesis that large domains can be expressed in a tolerogenic manner for multiple epitopes contained therein.

References

1.
Woods JM, Katschke KJ, Volin MV. et al. IL-4 Adenoviral gene therapy reduces inflammation, proinflammation cytokines, vascularization, and bony destruction in rat adjuvant-induced arthritis. J Immunol. 2001;166:1214–1222. [PubMed: 11145704]
2.
Chang Y, Prud'homme GJ. Intramuscular administration of expression plasmids encoding interferon-g receptor/IgG1 or IL-4/IgG1 chimeric proteins protects from autoimmunity. J Gene Med. 1999;1:415–423. [PubMed: 10753067]
3.
Costa GL, Sandora MR, Nakajima A. et al. Adoptive Immunotherapy of experimental autoimmune encephalomyelitis via T cell delivery of the IL-12p40 subunit. J Immunol. 2001;167:2379–2387. [PubMed: 11490028]
4.
Takiguchi M, Murakami M, Nakagawa I. et al. CTLA4-IgG gene delivery prevents autoantibody production and lupus nephritis in MRL/lpr mice. Life Sci. 2000;66:991–1001. [PubMed: 10724446]
5.
Quattrocchi E, Dallman MJ, Feldman M. Adenovirus-mediated gene transfer of CTLA4-Ig fusion protein in the suppression of experimental autoimmune arthritis. Arthritis Rheum. 2000;43:1688–1697. [PubMed: 10943858]
6.
Zambidis ET, Scott DW. Epitope-specific tolerance induction with an engineered immunoglobulin. Proc Natl Acad Sci USA. 1996;93:5019–5024. [PMC free article: PMC39399] [PubMed: 8643522]
7.
Zambidis ET, Barth RK, Scott DW. Both resting and activated B lymphocytes expressing engineered peptide-Ig molecules serve as highly efficient tolerogenic vehicles in immunocompetent adult recipients. J Immunol. 1997;158:2174–2182. [PubMed: 9036963]
8.
Zambidis ET, Kurup A, Scott DW. Genetically transferred central and peripheral immune tolerance via retroviral-mediated expression of immunogenic epitopes in hematopoietic progenitors or peripheral B-lymphocytes. Mol Med. 1997;3:212–224. [PMC free article: PMC2230045] [PubMed: 9100227]
9.
Kang Y, Melo M, Deng E. et al. Induction of hyporesponsiveness to intact foreign protein via retroviral-mediated gene expression: The IgG scaffold is important for induction and maintenance of immune hyporesponsiveness. Proc Natl Acad Sci USA. 1999;96:8609–8614. [PMC free article: PMC17564] [PubMed: 10411923]
10.
El-Amine M, Melo M, Scott DW. Gene therapy for tolerance and autoimmunity: Soon to be fulfilled promises? Clin Immunol. 2001;99:1–6. [PubMed: 11286536]
11.
Melo M, El-Amine M, Tonnetti L. et al. Gene therapeutic approaches to induction and maintenance of tolerance. Int Rev Immunol. 2001;20:627–645. [PubMed: 11890616]
12.
Scott DW, Venkataraman M, Jandinski JJ. Multiple pathways of B-cell tolerance. Immunol Rev. 1979;43:241–273. [PubMed: 365712]
13.
Venkataraman M, Scott DW. Cellular events in tolerance. VII. Decrease in clonable precursors stimulatable in vitro by specific antigens or LPS. Cell Immunol. 1979;47:323–331. [PubMed: 314857]
14.
Aldo-Benson M, Borel Y. The tolerant cell: direct evidence for receptor blockade. J Immunol. 1974;112:1793–1803. [PubMed: 4594416]
15.
Venkataraman M, Aldo-Benson M, Borel Y. et al. Persistence of antigen-binding cells with surface tolerogen: Isologous versus heterologous immunoglobulin carriers. J Immunol. 1977;119:1006–1009. [PubMed: 70467]
16.
Min B, Legge LK, Caprio JC. et al. Differential control of neonatal tolerance by antigen dose versus extended exposure and adjuvant. Cell Immunol. 2000;200:45–55. [PubMed: 10716882]
17.
Kang J, Wither J, Hozumi N. Long-term expression of a T-cell receptor beta-chain gene in mice reconstituted with retrovirus-infected hematopoietic stem cells. Proc Natl Acad Sci USA. 1990;87:9803–9807. [PMC free article: PMC55262] [PubMed: 2175916]
18.
El-Amine M, Hinshaw JA, Scott DW. In vivo induction of tolerance by an Ig peptide is not affected by the deletion of FcR or a mutated IgG Fc fragment. Int Immunol. 2002;14:761–766. [PubMed: 12096035]
19.
Ravetch JV, Bolland S. IgG Fc receptors. Ann Rev Immunol. 2001;19:275–290. [PubMed: 11244038]
20.
El-Amine M, Melo M, Kang Y. et al. Mechanisms of tolerance induction by a gene-transferred peptide-IgG fusion protein expressed in B lineage cells. J Immunol. 2000;165:5631–5636. [PubMed: 11067919]
21.
Krieg AM, Yi AK, Matson S. et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995;374:546–549. [PubMed: 7700380]
22.
Bluestone JA. Is CTLA-4 a master switch for peripheral T cell tolerance? J Immunol. 1997;158:1989–1993. [PubMed: 9036940]
23.
Krummel MF, Allison JP. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J Exp Med. 1995;182:459–465. [PMC free article: PMC2192127] [PubMed: 7543139]
24.
Maraskovsky E, Brasel K, Teepe M. et al. Dramatic increase in the numbers of functionally mature cells in Flt3 ligand-treated mice: Multiple dendritic cell subpopulations identified. J Exp Med. 1996;184:1953–1962. [PMC free article: PMC2192888] [PubMed: 8920882]
25.
Pulendran B, Smith JL, Jenkins M. et al. Prevention of pripheral tolerance by a dendritic cell growth factor: Flt3 ligand as an adjuvant. J Exp Med. 1998;188:2075–2082. [PMC free article: PMC2212387] [PubMed: 9841921]
26.
Pack CD, Cestra AE, Min B. et al. Neonatal exposure to antigen primes the immune system to develop responses in various lymphoid organs and promotes bystander regulation of diverse T cell specificities. J Immunol. 2001;167:4187–95. [PubMed: 11591739]
27.
Agarwal RK, Kang Y, Zambidis E. et al. Retroviral gene transfer of an immunoglobulin-antigen fusion construct protects from experimental autoimmune uveitis. J Clin Invest. 2000;106:245–252. [PMC free article: PMC517488] [PubMed: 10903340]
28.
Melo M, Qian J, El-Amine M. et al. Gene transfer of Ig-fusion proteins into B cells prevents and treats autoimmune diseases. J Immunol. 2002;168:4788–4795. [PubMed: 11971030]
Copyright © 2000-2013, Landes Bioscience.
Bookshelf ID: NBK6126

Views

  • PubReader
  • Print View
  • Cite this Page

Related information

  • PMC
    PubMed Central citations
  • PubMed
    Links to PubMed

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...