NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.
Medical Genetics Summaries [Internet]. Bethesda (MD): National Center for Biotechnology Information (US); 2012-.
Introduction
Fluorouracil, or 5-flourouracil (5-FU), is a chemotherapy agent that belongs to the drug class of fluoropyrimidines. When given as an intravenous (IV) solution, 5-FU is used in the palliative management of carcinoma of many solid tumors including (but not limited to) colon, rectum, breast, esophagus, cholangiocarcinoma (bile duct cancers), stomach, and pancreas. When prescribed as a cream or solution for topical use, fluorouracil (brand names Carac, Efudex, Fluoroplex, Tolak) is used to treat multiple actinic or solar keratoses of the face and scalp. Capecitabine (brand name Xeloda or CAPE) is the oral pill form of 5-FU chemotherapy, which is used interchangeably with 5-FU IV chemotherapy. Although it is the same drug, the oral pill version has certain side effects that are more pronounced (for example, diarrhea or skin related side effects – ‘hand-foot’ syndrome). Given the common usage of 5-FU for a variety of malignancies and potentially fatal overdoses, an antidote has been developed—uridine triacetate—which may be useful for pharmacogenetic-related overdoses, as well.
The DPYD gene encodes dihydropyrimidine dehydrogenase (DPD), an enzyme that catalyzes the rate-limiting step in fluorouracil metabolism. Genetic variations in the DPYD gene can lead to enzymes with reduced or absent activity. Individuals who have at least one copy of a non-functional DPYD variant [for example, DPYD*2A (c.1905+1G>A) or DPYD*13 (c.1679T>G)] will not be able to metabolize fluorouracil at normal rates. Consequently, they are at risk of potentially life-threatening fluorouracil toxicity, such as bone marrow suppression, diarrhea, and neurotoxicity. The prevalence of DPD partial deficiency varies in different populations but is approximately 35%. Complete absence of DPD function, which is often fatal with exposure to 5-FU chemotherapy, occurs in <1% (~0.2%) of the general population.
The FDA-approved drug label for fluorouracil states that no dose of fluorouracil has been proven safe in individuals with absent DPD activity (Table 1). Fluorouracil is contraindicated in individuals who are known to have complete DPD deficiency, or when complete deficiency is suspected because of early-onset or unusually severe fluorouracil toxicity (1).
The Clinical Pharmacogenetics Implementation Consortium (CPIC) and the Dutch Pharmacogenetics Working Group (DPWG) have published dosing recommendations for fluoropyrimidines (fluorouracil and capecitabine) based on DPYD genotype (Tables 2 and 3). Both recommendations include dose reductions for intermediate metabolizers (with reduced enzyme activity) and avoiding fluorouracil or capecitabine and choosing an alternative agent for poor metabolizers (with absent enzyme activity).
Table 1.
The FDA Drug Label for Fluorouracil: Warning DPD Deficiency (2020)
| Phenotype | Fluorouracil |
|---|---|
| DPD deficiency | Increased risk of serious or fatal adverse reactions in individuals with low or absent dihydropyrimidine dehydrogenase (DPD) activity. Withhold or permanently discontinue fluorouracil or its oral pill version capecitabine in individuals with evidence of acute early-onset or unusually severe toxicity, which may indicate near complete or total absence of DPD activity. No fluorouracil dose has been proven safe in individuals with absent DPD activity. |
Please see Therapeutic Recommendations based on Genotype for more information from the FDA. This table is adapted from (1).
Table 2.
The CPIC Recommended Dosing of Fluoropyrimidines (5-fluorouracil or capecitabine) by DPD Phenotype (2017, Nov 2018 Update)
| Phenotype | Implications for phenotypic measures | Activity score | Dosing recommendations | Classification of recommendationsa |
|---|---|---|---|---|
| DPYD normal metabolizer | Normal DPD activity and “normal” risk for fluoropyrimidine toxicity. | 2 | Based on genotype, there is no indication to change dose or therapy. Use label-recommended dosage and administration. | Strong |
| DPYD intermediate metabolizer | Decreased DPD activity (leukocyte DPD activity at 30–70% that of the normal population) and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugs. | 1–1.5 | Reduce starting dose by 50%, followed by dose titration based on clinical judgement (and ideally therapeutic drug monitoring) Individuals with homozygous c.[2846A>T];[2846A>T] genotype, a >50% reduction in starting dose may be warranted. | Moderate |
| DPYD poor metabolizer | Complete DPD deficiency and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugs | 0.5 | Avoid use of 5-fluorouracil or 5-fluorouracil prodrug-based regimens. In the event, based on clinical advice, alternative agents are not considered a suitable therapeutic option, 5-fluorouracil should be administered at a strongly reduced dosec with early therapeutic drug monitoring.d | Strong |
| 0 | Avoid use of 5-fluorouracil or 5-fluorouracil prodrug-based regimens. |
CPIC, Clinical Pharmacogenetics Implementation Consortium
DPD, dihydropyrimidine dehydrogenase.
- a
Rating scheme is described in Supplement (2).
- b
Increase the dose in individuals experiencing no or clinically tolerable toxicity in the first 2 cycles to maintain efficacy; decrease the dose in individuals who do not tolerate the starting dose to minimize toxicities.
- c
If available, a phenotyping test (see main text for further details) should be considered to estimate the starting dose. In the absence of phenotyping data, a dose of <25% of the normal starting dose is estimated assuming additive effects of alleles on 5-flourouracil clearance. dTherapeutic drug monitoring should be done at the earliest timepoint possible (for example, minimum timepoint in steady state) in order to immediately discontinue therapy if the drug level is too high.
Note: The nomenclature used in this table reflects the standardized nomenclature for pharmacogenetic terms proposed by CPIC in a 2016 paper, “Standardizing terms for clinical pharmacogenetic test results: consensus terms from the Clinical Pharmacogenetics Implementation Consortium (CPIC)” (4).
Table 3.
The DPWG Recommendations for Capecitabine/Fluorouracil by DPYD Gene Activity, Systemic Route of Administration (2019)
| DPYD gene activity score | Recommendation | Pharmacist text |
|---|---|---|
| Activity score 1.5 | Start with 50% of the standard dose or avoid fluorouracil and capecitabine. After starting treatment, the dose should be adjusted based on toxicity and effectiveness. Tegafur is not an alternative, as this is also metabolized by DPD. | The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose |
| Activity score 1.0 | Start with 50% of the standard dose or choose an alternative. Adjustment of the initial dose should be guided by toxicity and effectiveness. Tegafur is not an alternative, as this is also metabolized by DPD. | Genetic variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose. |
| PHENO1 | It is not possible to recommend a dose adjustment for these individuals based on the genotype only. Determine the residual DPD activity in mononuclear cells from peripheral blood and adjust the initial dose based on phenotype and genotype or avoid fluorouracil and capecitabine. Tegafur is not an alternative, as this is also metabolized by DPD. | The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose. |
| Activity score 0 | Avoid fluorouracil and capecitabine Tegafur is not an alternative, as this is also metabolized by DPD. If an alternative is not possible: determine the residual DPD activity in mononuclear cells from peripheral blood and adjust the initial dose accordingly. An individual with 0.5% of the normal DPD activity tolerated 0.8% of the standard dose (150 mg capecitabine every 5 days). An individual with undetectable DPD activity tolerated 0.43% of the standard dose (150 mg capecitabine every 5 days with every third dose skipped). | Genetic variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the standard dose is a more than 100-fold overdose. |
Drug Class: Fluoropyrimidines
Fluoropyrimidines are a class of antimetabolite drugs that are widely used in the treatment of cancer. There are 3 types of fluoropyrimidines in clinical use: capecitabine (oral - pill) and 5-fluorouracil (5-FU – IV), which are licensed for use in the US, and tegafur, which is not available in the US. Capecitabine and tegafur are both active precursors of fluorouracil.
Fluoropyrimidines are thought to exert their chemotherapeutic effects in multiple ways, through several active metabolites. The main mechanism of action is thought to be the inhibition of thymidylate synthase, which plays an important part in the folate-homocysteine cycle, and purine and pyrimidine synthesis pathways. Also, active metabolites can be incorporated into RNA and DNA, ultimately leading to cell death (7). Based on their mechanism of action, fluoropyrimidines can cause fetal harm when administered to a pregnant woman (1).
Approximately 10–40% of individuals develop severe and potentially life-threatening toxicity early during treatment with fluoropyrimidines (8). This toxicity typically leads to an interruption or discontinuation of potentially effective anticancer therapy, and may require an emergency room visit or hospitalization in severe instances (9).
The interindividual variation in the occurrence and severity of adverse events in individuals receiving fluoropyrimidines can be partly explained by clinical factors, such as age and gender. However, much of the variability in adverse events remains unexplained (10).
Of the genetic factors thought to contribute to fluoropyrimidine intolerance, the DPYD gene has been the most studied. This gene encodes the primary enzyme involved in breaking down fluoropyrimidines to inactive metabolites. Individuals who have a deficiency of the DPD enzyme have a significantly increased risk of suffering from severe fluoropyrimidine toxicity, and the stratification of individuals on the basis of the DPYD genotype may help to prevent such adverse events (11, 12, 13, 14, 15, 16).
Drug: Fluorouracil
Fluorouracil is a form of chemotherapy that is given as an IV solution, and is used to manage many cancers, including carcinoma of the colon, rectum, breast, stomach, and pancreas. Fluorouracil may also be used topically as a cream or a solution, for the treatment of multiple actinic or solar keratoses of the face and anterior scalp.
Fluorouracil is structurally similar to pyrimidines, and the enzyme that catalyzes the rate-limiting step in the breakdown of pyrimidines (DPD) also catalyzes the rate-limiting step in 5-FU catabolism. The DPD enzyme catalyzes the conversion of fluorouracil to the non-cytotoxic dihydrofluorouracil (DHFU) (17).
The FDA states that fluorouracil therapy should be discontinued promptly whenever one of the following signs of toxicity appears:
- Cardiotoxicity including angina, myocardial infarction/ischemia, arrhythmia, and heart failure
- Hyperammonemic encephalopathy
- Neurologic toxicity, including acute cerebellar syndrome
- Mucositis, stomatitis or esophagopharyngitis, which may lead to mucosal sloughing or ulceration
- Myelosuppression, which may include neutropenia, thrombocytopenia, and anemia
- Diarrhea (grade 3 or 4), frequent bowel movements, or watery stools
- Palmar-plantar erythrodysesthesia (hand-foot syndrome), grade 2 or 3
The FDA label also indicates that uridine triacetate should be administered within 96 hours following the end of fluorouracil infusion for management of fluorouracil overdose. (1) Uridine triacetate (brand name Vistogard) was approved December 11, 2015 (18). Exogenous uridine competes with 5-FU for incorporation into RNA, thus diluting the toxic effects of high 5-FU levels. Uridine triacetate is 4–6-fold higher in bioavailability than equimolar doses of uridine (19).
Uridine triacetate is meant for overdose treatment of adults or children; however, can be considered in situations of individuals with pharmacogenetic deficiency, which is technically an overdose (20, 21). This compound can also be used in the context of capecitabine overdose (19). The high cost of a single course of uridine triacetate therapy has been cited as a potential barrier to therapy. Nevertheless, 94% of clinical trial participants treated with uridine triacetate survived the overdose event, a notable improvement over the historic mortality rate of 84% (19).
Symptomatic DPD deficiency is a rare autosomal recessive disorder with a wide range of symptoms, ranging from no symptoms or signs, to severe neurological problems. In affected individuals, the absent or greatly decreased DPD activity results in uracil and thymine accumulating in the blood, urine, and cerebrospinal fluid. Neurological symptoms typically manifest in early childhood and include seizures, small head size, and delayed cognitive and motor development (22).
Symptomatic DPD deficiency is typically caused by homozygous inactivation of DPYD; whereas individuals who are heterozygotes tend to be asymptomatic. However, all individuals with less than 70% DPD activity are considered at risk for the development of severe drug toxicity when treated with fluoropyrimidines (23). Signs of fluorouracil toxicity include severe diarrhea, severe mucositis, neutropenia, neurotoxicity, and hand-foot syndrome (redness, swelling, and blisters on the palms of the hands an soles of the feet) (1).
Gene: DPYD
The DPYD gene encodes the enzyme DPD, which catalyzes the first and rate-limiting step in the breakdown of the pyrimidine nucleotides thymine and uracil. The DPD enzyme also catalyzes the rate-limiting step in the breakdown of fluoropyrimidines.
Many DPYD variants have been described, although only a few have been demonstrated to influence DPD enzyme activity. When no variant is detected (formerly known as the *1 allele), it is associated with normal enzyme activity. Individuals who have 2 copies of normal activity DPYD alleles are known as “normal metabolizers” and have fully functional DPD enzyme activity (Table 4). The DPYD alleles c.1601G>A (*4, rs1801158), c.1627G>A (*5, rs1801159), c.2194G>A (*6, rs1801160), and c.85T>C (*9A, rs1801265) are also considered to have normal activity (24). Historically, variant haplotypes in DPYD have been identified by their star (*) allele names. However, the Pharmacogene Variation Database (PharmVar) now identifies these alleles by their dbSNP “rs” allele identifier or cDNA change based on the NM_000110.3 transcript, DPYD mRNA variant 1. All 3 of these identifiers are provided in the Nomenclature for Selected DPYD alleles table below.
Table 4.
Activity Status of Selected DPYD Alleles
| Allele type | Alleles | |
|---|---|---|
| Strong evidence to support function | Moderate evidence to support function | |
| Normal function | No variant detected (*1), c.1627G>A (*5, rs1801159), c.85T>C (*9A, rs1801265) | c.1601G>A (*4, rs1801158), c.2194G>A (*6, rs1801160), c.1003G>T (*11, rs72549306), c.2657G>A (*9B, rs1801267), 496A>G (rs2297595) |
| Decreased function | c.2846A>T (rs67376798), 1129-5923C>G and 1236G>A (HapB3) | c.557A>G (rs115232898) |
| No function | c.1905+1G>A (*2A, rs3918290) | c.1898delC (*3, rs72549303), c.295_298delTCAT (*7, rs72549309), c.703C>T (*8, rs1801266), c.2983G>T (*10, rs1801268), c.1156G>T (*12), c.1679T>G (*13, rs55886062) |
This table is adapted from the “DPYD Allele Functionality Table”, available from CPIC. Additional variant information from the PharmVar database. The cDNA coordinates for variation are given for NM_000110.3, DPYD transcript variant 1.
For the nomenclature of human DPYD alleles, please see (25).
CPIC, Clinical Pharmacogenetics Implementation Consortium
The non-functional DPYD variants that have been associated with absent DPD activity and an increased risk of toxicity with fluoropyrimidines include c.1905+1G>A (*2A, rs3918290) and c.1679T>G (*13, rs55886062) (26). Variants with decreased function include rs67376798 (c.2846A>T) and HapB3, which also are associated with an increased risk of fluoropyrimidine toxicity. The most well studied variant is DPYD c.1905+1G>A (*2A, rs3918290), in which a single nucleotide substitution at the invariant splice donor site of intron 14 leads to translation skipping exon 14, resulting in the production of a truncated protein with virtually no enzyme activity.
Individuals who have combinations of one normal function and one decreased function or no function DPYD alleles are known as “intermediate metabolizers”. Individuals with 2 decreased function alleles are also categorized as intermediate metabolizers. They have partial DPD deficiency and are at increased risk of capecitabine toxicity. And individuals who have a combination of non-functional DPYD alleles, or decreased function DPYD alleles, or both, are known as “poor metabolizers”. They have complete DPD deficiency and are at an even higher risk of capecitabine toxicity.
Activity scores may be used to distinguish between the various DPYD alleles and their functionality (Table 5). The use of activity scores may result in differentiated individualized dosing advice for fluoropyrimidines, which is beneficial for reducing toxic side effects while maintaining efficacy (15).
Table 5.
Assignment of likely DPD Phenotype based on DPYD Genotype (CPIC, 2017)
| Likely phenotype | Activity scorea | Genotypeb | Examples of genotypec |
|---|---|---|---|
| DPYD normal metabolizer | 2 | An individual with 2 normal function alleles. |
c.[=]; [=] |
| DPYD intermediate metabolizer (approximately 3–5% of individuals) | 1 or 1.5 | An individual with one normal function allele plus one no function allele or one decreased function allele, or an individual with 2 decreased function alleles. | c.[1905+1G>A]; [=] c.[1679T>G]; [=] c.[2846A>T]; [=] c.[1129–5923C>G]; [=]d c.[1129–5923C>G]; [1129–5923C>G]d c.[2846A>T]; [2846A>T] |
| DPYD poor metabolizer (approximately 0.2% of individuals) | 0 or 0.5 | An individual with 2 no function alleles or an individual with one no function plus one decreased function allele. | c.[1905+1G>A]; [1905+1G>A] c.[1679T>G]; [1679T>G] c.[1905+1G>A]; [2846A>T] c.[1905+1G>A]; [1129-5923C>G] |
"[ ]" Square brackets are used to indicate an allele, "[=]" Indicates the allele sequence was tested and no changes were found
- a
Calculated as the sum of the 2 lowest individual variant activity scores. See (2) for further information.
- b
Allele definitions, assignment of allele function and references can be found on the CPIC guideline page (DPYD Allele Functionality Table)
- c
HGVS nomenclature using the reference sequence NM_000110.3. Note: Guidelines for the description and nomenclature of gene variations are available from the Human Genome Variation Society (HGVS).
- d
Likely HapB3 causal variant. See DPYD Allele Functionality Table available or other HapB3 proxy SNPs.
This table is adapted from (2).
Note: The nomenclature used in this table reflects the standardized nomenclature for pharmacogenetic terms proposed by CPIC (4).
CPIC, Clinical Pharmacogenetics Implementation Consortium
Overall, the prevalence of individuals who are heterozygous for non-functional DPYD alleles (partially DPD deficient) and at risk of severe drug reactions is estimated to be as high as 5–8%, but this varies in different populations (8, 23, 27, 28, 29, 30, 31, 32). In Caucasians, approximately 3–5% of have partial DPD deficiency and 0.2% have complete DPD deficiency (29). Recent studies suggest that ~8% of Caucasians have at least one of the 4 well characterized altered-function alleles (33).
In African-Americans, the prevalence of decreased DPD enzyme activity is 8% (32). It is notable that despite being well studied, DPYD c.1905+1G>A (*2A, rs3918290) is incredibly rare in individuals of African ancestry (34). One study reported that the normal function c.85T>C (*9A, rs1801265) allele was present in 49% of African-American samples (35). The rs115232898 (c.557A>G) variant allele with reduced function was detected in 2.6% of African-heritage Brazilians (36).
Studies of Egyptian and Tunisian populations suggest the allelic frequencies for DPYD variants in these 2 countries are similar to Caucasian variant allele frequencies (37, 38). The frequency of the poor-metabolizer rs6376798 (c.2846A>T) allele in Mestizo and native Mexican populations is rare, but not significantly different than in MXL (Mexican Ancestry from Los Angeles USA) or CEU (Utah Residents (CEPH) with Northern and Western European Ancestry) populations in the 1000 Genomes Project (39).
Asian populations have slightly different allele frequencies as compared with African and European populations. The frequency of the c.85T>C (*9A, rs1801265) normal function variant was slightly lower in Han Chinese, Korean and Japanese populations, particularly compared with Africans, though the frequency of the c.2657G>A (*9B, rs1801267) normal function variant and c.295_298delTCAT (*7, rs72549309), c.703C>T (*8, rs1801266), and c.2983G>T (*10, rs1801268) no function alleles were similar across these groups (35). The c.1905+1G>A (*2A/*2B, rs3918290) and c.1679T>G (*13, rs55886062) no function alleles were not detected in a study of Hmong and East Asian descent individuals, underscoring the rarity of these alleles (40). An analysis of multiple genotyping studies in South Asian populations found that the rs2297595 (c.496A>G) allele was prevalent in south Asia (41).
Most individuals in the U.S. are not screened for DPD deficiency before starting fluorouracil therapy (42) and the FDA-approved label does not specifically recommend DPD testing (1). In contrast, the European Medicines Agency recommends testing for DPD deficiency before initiating treatment with any fluorouracil related substance via infusion or injection (43).
Gene: TYMS
Emerging studies and reports suggest genetic variation at another locus may also affect 5-FU efficacy and toxicity—TYMS. This gene encodes thymidylate synthase (TS), which catalyzes the methylation of deoxyuridylate to deoxythymidylate. This reaction is a rate-limiting step in production of an essential DNA synthesis precursor. The TS protein expression correlates positively with sensitivity to 5-FU, and the TS enzyme is one of the targets of 5-FU (44). While this functional link to 5-FU metabolism and tumor response has been demonstrated in multiple studies, the impact of specific genetic variants in TYMS is less clear (44, 45, 46, 47). Some TYMS alleles have been reported in a handful of studies as being associated with increased toxicity and anti-tumor cell response with fluoropyrimidines.
The rs45445694 variant is the basis of the TYMS “2R” allele, which has been associated with clinical response and severe toxicity events, either in homozygosity or heterozygosity (20, 48, 49, 50). This 2R variant occurs in the 5’UTR and is duplication of a 28 base pair (bp) repeat. This same locus can have variable tandem repeats between 0 and 9 copies, and studies suggest that the increased copy number of the repeat is associated with increased TYMS expression and TS protein levels (51).
One additional variant in TYMS has been found in association with adverse reactions to fluoropyrimidine therapy: a 3'UTR 9bp-indel (rs11280056) (49, 51). There are conflicting reports as to whether this is a 6- or 9-bp indel. One variant (rs2853542) within the TYMS enhancer region in the context of the 28bp tandem repeat triplication, called 3RG or 3RC based on the specific nucleotide present, has also been reported in association with neurotoxicity during 5-FU treatment (52). The presence of the C nucleotide at rs2853542 has been associated with decreased expression of TYMS mRNA (53).
PharmGKB has described TYMS as a ‘Very Important Pharmacogene’, though the level of evidence for TYMS and capecitabine/5-fluorouracil interaction is limited (PharmGKB “level 3”) (51). The CPIC also views this interaction as having limited evidence and thus provides no prescribing recommendations for these pharmacogenetic variants (54).
Linking Gene Variation with Treatment Response
Standard doses of fluorouracil increase the risk of severe toxicity in individuals who are carriers of specific DPYD variant alleles, and no dose of fluorouracil is considered safe among individuals with absent DPD activity (1, 55). Multiple studies have found that preemptive DPYD screening for individuals with cancer can significantly improve individual safety (56, 57, 58, 59, 60, 61). Of note, at least one case report indicated that the cost of administering uridine triacetate and palliative care following an adverse, overdose reaction to 5-FU was roughly $180,000 USD (20).
Genetic Testing
The NIH Genetic Testing Registry, GTR, displays genetic tests that are available for the DPYD gene and the fluorouracil drug response. The DPYD c.1905+1G>A (*2A, rs3918290) variant is the most commonly tested; however, newly discovered and rare variants may also lead to enzyme inactivation and toxicity to fluoropyrimidine-based chemotherapy (36, 62, 63, 64, 65).
Biochemical genetic tests may also be used, which assess the activity of the DPD enzyme. These tests include biochemical assays such as analyte testing (for example, measuring the amount of thymine and uracil in the urine or blood) or an enzyme assay (for example, directly measuring the activity of DPD using RNA extracted from blood cells and measuring the DPD mRNA copy number) (66, 67, 68).
The GTR provides a list of biochemical tests that assess the levels of thymine and uracil analytes, and the activity of the enzyme DPD.
Therapeutic Recommendations based on Genotype
This section contains excerpted1 information on gene-based dosing recommendations. Neither this section nor other parts of this review contain the complete recommendations from the sources.
2020 Statement from the US Food and Drug Administration (FDA)
WARNINGS AND PRECAUTIONS: Increased Risk of Serious or Fatal Adverse Reactions in Patients with Low or Absent [Dihydropyrimidine] Dehydrogenase (DPD) Activity
Based on postmarketing reports, patients with certain homozygous or certain compound heterozygous mutations in the DPD2 gene that result in complete or near complete absence of DPD activity are at increased risk for acute early-onset of toxicity and severe, life-threatening, or fatal adverse reactions caused by fluorouracil (e.g., mucositis, diarrhea, neutropenia, and neurotoxicity). Patients with partial DPD activity may also have increased risk of severe, life-threatening, or fatal adverse reactions caused by fluorouracil.
Withhold or permanently discontinue fluorouracil based on clinical assessment of the onset, duration and severity of the observed toxicities in patients with evidence of acute early-onset or unusually severe toxicity, which may indicate near complete or total absence of DPD activity. No fluorouracil dose has been proven safe for patients with complete absence of DPD activity. There is insufficient data to recommend a specific dose in patients with partial DPD activity as measured by any specific test.
[…]
PATIENT COUNSELING INFORMATION
Advise patients to notify their healthcare provider if they have a known DPD deficiency.
Advise patients if they have complete or near complete absence of DPD activity, they are at an increased risk of severe and life-threatening mucositis, diarrhea, neutropenia and neurotoxicity.
[…]
OVERDOSAGE
Administer uridine triacetate within 96 hours following the end of fluorouracil infusion for management of fluorouracil overdose.
Please review the complete therapeutic recommendations that are located here: (1).
2017 Statement from the Clinical Pharmacogenetics Implementation Consortium (CPIC), with November 2018 Update
[…]
Table 2 summarizes the genetics-based dosing recommendations for fluoropyrimidines using the calculated DPYD activity score (DPYD-AS). The strength of the prescribing recommendations is based on the known impact of some variants (c.1905+1G>A, c.1679T>G, c.2846A>T, c.1129–5923C>G) on DPD activity, the demonstrated relationship between DPD activity and 5- fluorouracil clearance, and between 5-fluorouracil exposure and its toxic effects. Patients who are heterozygous for DPYD decreased/no function variants demonstrate partial DPD deficiency and should receive reduced starting doses. Prospective genotyping of c.1905+1G>A followed by a 50% dose reduction in heterozygous carriers resulted in a rate of severe toxicity comparable to noncarriers[see (9)]. This study thus demonstrated that DPYD genetic testing can reduce the occurrence of severe fluoropyrimidine-related toxicity, and that a dose reduction of 50% is suitable for heterozygous carriers of no function variants (DPYD-AS: 1). For decreased function variants, evidence is limited regarding the optimal degree of dose reduction. For c.2846A>T, a small retrospective study observed that the average capecitabine dose in heterozygous carriers was reduced by 25% compared to noncarriers. In a small prospective study, five patients carrying c.1236G>A (proxy for c.1129–5923C>G) were safely treated with a 25% reduced capecitabine starting dose. This suggests that heterozygous carriers of decreased function variants (DPYD-AS: 1.5) may tolerate higher doses com- pared to carriers of no function variants (DPYD-AS: 1). In patients with DPYD-AS of 1.5, the individual circumstances of a given patient should therefore be considered to determine if a more cautious approach (50% starting dose followed by dose titration), or an approach maximizing potential effectiveness with a potentially higher toxicity risk (25% dose reduction) is preferable. Of note, both studies indicating the suitability of a 25% dose reduction in decreased function variant carriers included only patients receiving capecitabine and no data are currently available for infusional 5-fluorouracil.
Given that some patients carrying decreased or no function variants tolerate normal doses of 5-fluorouracil, to maintain effectiveness, doses should be increased in subsequent cycles in patients experiencing no or clinically tolerable toxicity in the first two chemotherapy cycles or with subtherapeutic plasma concentrations. Similarly, doses should be decreased in patients who do not tolerate the starting dose.
In DPYD poor metabolizers (DPYD-AS: 0.5 or 0), it is strongly recommended to avoid use of 5-fluorouracil-containing regimens. However, if no fluoropyrimidine-free regimens are considered a suitable therapeutic option, 5-fluorouracil administration at a strongly reduced dose combined with early therapeutic drug monitoring may be considered for patients with DPYD-AS of 0.5. It should be noted, however, that no reports of the successful administration of low-dose 5-fluorouracil in DPYD poor metabolizers are available to date. Assuming additive effects of decreased and no function alleles (DPYD-AS: 0.5), it is estimated that a dose reduction of at least 75% would be required (i.e., starting dose <25% of normal dose). Furthermore, in such cases a phenotyping test is advisable to estimate DPD activity and a starting dose.
The US Food and Drug Administration (FDA) and the Health Canada Santé Canada (HCSC) have added statements to the drug labels for 5-fluorouracil and capecitabine that warn against use in patients with DPD deficiency, and prescribing recommendations for 5-fluorouracil, capecitabine, and tegafur are also available from the Dutch Pharmacogenetics Working Group.
November 2018 Update:
The current DPYD guideline recommends to reduce the dose of fluoropyrimidines by 25-50% (from the full standard dose) in DPYD Intermediate Metabolizers with an activity score of 1.5. At the time of the guideline publication, this dose range was recommended due to limited evidence for genotype-guided dosing of decreased function alleles/variants. However, a recent prospective study (PMID: 30348537) provides evidence to support a recommendation for a 50% dose reduction in heterozygous carriers of the decreased function variants c.2846A>T (rs67376798) or c.1129–5923C>G (rs75017182; HapB3 or its tagging SNP c.1236G>A; rs56038477). These data suggest that all Intermediate Metabolizers with an activity score of 1.5 should receive a 50% dose reduction.
Therefore CPIC revises its recommendation such that all DPYD Intermediate Metabolizers should receive a 50% dose reduction from the full standard starting dose, whether the activity score is 1 or 1.5 followed by dose titration, based on clinical judgement and ideally therapeutic drug monitoring.
In addition, recent case reports from patients who are homozygous for c.2846A>T (activity score of 1) indicate that a dose reduction of more than 50% may be required in some carriers of this genotype. Therefore, in patients with an activity score of 1 due to a homozygous c.[2846A>T];[2846A>T] genotype, clinicians should be aware that a >50% reduction in starting dose might be warranted.
Please review the complete therapeutic recommendations that are located here: (2, 3)
2019 Summary of recommendations from the Dutch Pharmacogenetics Working Group (DPWG) of the Royal Dutch Association for the Advancement of Pharmacy (KNMP)
DPD Gene Activity Score 0
The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the standard dose is a more than 100-fold overdose.
- Avoid fluorouracil and capecitabine
Tegafur is not an alternative, as this is also metabolized by DPD.
- If it is not possible to avoid fluorouracil and capecitabine: determine the residual DPD activity in mononuclear cells from peripheral blood and adjust the initial dose accordingly.
A patient with 0.5% of the normal DPD activity tolerated 0.8% of the standard dose (150 mg capecitabine every 5 days). A patient with undetectable DPD activity tolerated 0.43% of the standard dose (150 mg capecitabine every 5 days with every third dose skipped)
DPD [PHENO] [phenotyping indicates reduced function]
The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose.
It is not possible to recommend a dose adjustment for this patient based on the genotype only.
- determine the residual DPD activity in mononuclear cells from peripheral blood and adjust the initial dose based on phenotype and genotype, or avoid fluorouracil and capecitabine.
Tegafur is not an alternative, as this is also metabolized by DPD.
DPD Gene Activity Score 1
The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose.
- Start with 50% of the standard dose or avoid fluorouracil and capecitabine.
Adjustment of the subsequent dose should be guided by toxicity and effectiveness. However, in one study involving 17 patients with gene activity 1, the average dose after titration was 57% of the standard dose.
Tegafur is not an alternative, as this is also metabolized by DPD.
DPD Gene Activity Score 1.5
The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose.
- Start with 50% of the standard dose or avoid fluorouracil and capecitabine.
After starting treatment, the dose should be adjusted based on toxicity and effectiveness. In a study involving 17 patients with genotype 1/2846T, the average dose after titration was 64% of the standard dose. For 51 patients with genotype 1/1236A, the average dose after titration was 74% of the standard dose. Tegafur is not an alternative, as this is also metabolized by DPD.
DPD Gene Activity Score 0 (Cutaneous fluorouracil)
The gene variation increases the risk of severe, potentially fatal toxicity. A reduced conversion of fluorouracil/capecitabine to inactive metabolites means that the normal dose is an overdose.
- avoid fluorouracil
NOTE: If a patient has two different genetic variations that lead to a non-functional DPD enzyme (e.g. *2A and *13), this recommendation only applies if the variations are on a different allele. If both variations are on the same allele, this patient actually has a gene activity score 1, for which no increased risk of severe, potentially fatal toxicity has been found with cutaneous use. These two situations can only be distinguished by determining the enzyme activity (phenotyping). This recommendation only applies if the patient has virtually no enzyme activity.
Background Information - Mechanism
Fluorouracil is mainly (> 80%) converted by dihydropyrimidine dehydrogenase (DPD) to inactive metabolites. Lower metabolic activity of DPD leads to increased intracellular concentrations of fluorodeoxyuridine monophosphate, the active metabolite of fluorouracil and its prodrug capecitabine. This leads to an increased risk of adverse events such as neutropenia, thrombopenia and hand-foot syndrome.
For more information about the phenotype gene activity score: see the general background information about DPD on the KNMP Knowledge Bank or on www.knmp.nl (search for DPD).
Please review the complete therapeutic recommendations that are located here: (5) .
Nomenclature for Selected Alleles
DPYD Alleles
| Common allele name | Alternative names | HGVS reference sequence | dbSNP reference identifier for allele location | |
|---|---|---|---|---|
| Coding | Protein | |||
| rs3918290 | DPYD*2A, c.1905+1G>A | NM_000110.4:c.1905+1G>A | Not applicable—deletion of exon 14 leads to the production of a truncated protein | rs3918290 |
| IVS14+1G>A | ||||
| rs55886062 | DPYD*13, c.1679T>G, rs55886062.1, p.Ile560Ser | NM_000110.4:c.1679T>G | NP_000101.2:p.Ile560Ser | rs55886062 |
| rs67376798 | c.2846A>T p.Asp949Val | NM_000110.4:c.2846A>T | NP_000101.2:p.Asp949Val | rs67376798 |
| rs75017182 | c.1129–5923C>G | NM_000110.4:c.1129-5923C>G | rs75017182 | |
| rs1801159 | DPYD*5, c.1627G>A | NM_000110.4:c.1627A>G | NP_000101.2:p.Ile543Val | rs1801159 |
| rs1801265 | DPYD*9A, c.85T>C | NM_000110.4:c.85T>C | NP_000101.2:p.Cys29Arg | rs1801265 |
| rs1801158 | DPYD*4, c.1601G>A | NM_000110.4:c.1601G>A | NP_000101.2:p.Ser534Asn | rs1801158 |
| rs1801160 | DPYD*6, c.2194G>A | NM_000110.4:c.2194G>A | NP_000101.2:p.Val732Ile | rs1801160 |
| rs72549306 | DPYD*11, c.1003G>T, rs72549306.1 | NM_000110.4:c.1003G>T | NP_000101.2:p.Val335Leu | rs72549306 |
| rs1801267 | DPYD*9B, c.2657G>A | NM_000110.4:c.2657G>A | NP_000101.2:p.Arg886His | rs1801267 |
| rs72549303 | DPYD*3, c.1898delC | NM_000110.4:c.1898del | NP_000101.2:p.Pro633fs | rs72549303 |
| rs72549309 | DPYD*7, c.295_298delTCAT | NM_000110.4:c.295_298TCAT[1] | NP_000101.2:p.Phe100fs | rs72549309 |
| rs1801266 | DPYD*8, c.703C>T | NM_000110.4:c.703C>T | NP_000101.2:p.Arg235Trp | rs1801266 |
| rs1801268 | DPYD*10, c.2983G>T | NM_000110.4:c.2983G>T | NP_000101.2:p.Val995Phe | rs1801268 |
| rs78060119 | DPYD*12, c.1156G>T | NM_000110.4:c.1156G>T | NP_000101.2:p.Glu386Ter | rs78060119 |
| rs115232898 | 557A>G (Y186C) | NM_000110.4:c.557A>G | NP_000101.2:p.Tyr186Cys | rs115232898 |
| rs2297595 | 496A>G (M166V) | NM_000110.4:c.496A>G | NP_000101.2:p.Met166Val | rs2297595 |
| rs75017182 rs56038477 | HapB3 1129-5923C>G 1236G>A |
NM_000110.4:c.1129-5923C>G
NM_000110.4:c.1236G>A | Altered mRNA splicing due to cryptic splice donor site leads to retention of intronic sequence, introduces premature termination codon in resulting protein. |
rs75017182
rs56038477 |
| NP_000101.2:p.Glu412= | ||||
TYMS Alleles
| Common allele name | Alternative names | HGVS reference sequence | dbSNP reference identifier for allele location |
| rs45445694 | 2R, 3R TYMS 5’UTR | GRCh37.p13 chr 18, NC_000018.9:g.657657_657712del, NC_000018.9:g.657657_657684GGCCTGCCTCCGTCCCGCCGCGCCACTT[1]-[9]# | rs45445694 |
| rs11280056 | TYMS 3’UTR | GRCh37.p13 chr 18, NC_000018.9:g.673447_673452del, NC_000018.9:g.673447_673452dup#
NM_017512.7:c.*856_*861del | rs11280056 |
| rs2853542 | TYMS 3RG, 3RC | GRCh37.p13 chr 18, NC_000018.9:g.657685G>C# NM_001071.4:c.-58= | rs2853542 |
- #
This is a non-coding variant in the TYMS untranslated region. Coordinates given are chromosomal.
Pharmacogenetic Allele Nomenclature: International Workgroup Recommendations for Test Result Reporting (69).
Allele information for DPYD can also be found at the Pharmacogene Variation Consortium (PharmVar).
Guidelines for the description and nomenclature of gene variations are available from the Human Genome Variation Society (HGVS).
Acknowledgments
2021 Edition (v.2)
The author would like to thank Ayman Madi, MD, MCRP, Consultant Medical Oncologist, The Clatterbridge Cancer Centre NHS Foundation Trust, Liverpool, UK; Masahiro Hiratsuka, PhD, Associate Professor, Laboratory of Pharmacotherapy of Life-Style Related Diseases, Graduate School of Pharmaceutical Sciences Tohoku University, Sendai, Japan; Linda M. Henricks, PharmD, Department of Clinical Chemistry and Laboratory Medicine, Leiden University Medical Center, Leiden, the Netherlands; Pashtoon Kasi, MD, MS, Clinical Assistant Professor of Internal Medicine - Hematology, Oncology and Blood and Marrow Transplantation, Department of Internal Medicine, University of Iowa Health Care, Iowa City, IA, USA; and Mandy van Rhenen, PharmD, Royal Dutch Pharmacists Association, Drug Information Centre KNMP, The Hague, the Netherlands for reviewing this summary.
2016 Edition (v.1)
The author would like to thank George P. Patrinos, Associate Professor of Pharmacogenomics and Pharmaceutical Biotechnology, University of Patras, Department of Pharmacy, Patras, Greece; Mohamed Nagy, Clinical Pharmacist, Head of the Personalised Medication Management Unit, Department of pharmaceutical Services, Children's Cancer Hospital, Cairo, Egypt; and Victoria M. Pratt, PhD, FACMG, Director, Pharmacogenomics Laboratory, Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN, USA for reviewing this summary.
Version History
A minor revision to this summary was made on May 11, 2026 to update URLs for CPIC information (v 2.2).
A minor revision to this summary (v 2.1) was made on August 14, 2025 to update the URL for a citation.
A major update to this summary was published on January 11, 2021 (v 2.0).
To view the 2016 version (v 1) of this summary (created 3 November 2016), please click here.
References
- 1.
- FLUOROURACIL - fluorouracil injection, solution [package insert]. Illinois, USA: FreseniusKabi; 2020. Available from: https://dailymed
.nlm .nih.gov/dailymed/drugInfo .cfm?setid=c45f5286-a52b-43e5-8a6f-d0312e7da0c8. - 2.
- Amstutz, U., L.M. Henricks, S.M. Offer, J. Barbarino, et al., Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing: 2017 Update. Clin Pharmacol Ther, 2018. 103(2): p. 210–216. [PMC free article: PMC5760397] [PubMed: 29152729]
- 3.
- CPIC® Guideline for Fluoropyrimidines and DPYD. 2020; Available from: https://www
.clinpgx.org /guideline/PA166251462. - 4.
- Caudle, K.E., H.M. Dunnenberger, R.R. Freimuth, J.F. Peterson, et al., Standardizing terms for clinical pharmacogenetic test results: consensus terms from the Clinical Pharmacogenetics Implementation Consortium (CPIC). Genet Med, 2017. 19(2): p. 215–223. [PMC free article: PMC5253119] [PubMed: 27441996]
- 5.
- Royal Dutch Pharmacists Association (KNMP). Dutch Pharmacogenetics Working Group (DPWG). Pharmacogenetic Guidelines [Internet]. Netherlands. DPD- 5-fluoruracil/capecitabine [Cited 2020]. Available from https://www
.knmp.nl/dossiers /farmacogenetica /pharmacogenetics - 6.
- Lunenburg, C., C.H. van der Wouden, M. Nijenhuis, M.H. Crommentuijn-van Rhenen, et al., Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines. Eur J Hum Genet, 2020. 28(4): p. 508–517. [PMC free article: PMC7080718] [PubMed: 31745289]
- 7.
- Wilson, P.M., P.V. Danenberg, P.G. Johnston, H.J. Lenz, et al., Standing the test of time: targeting thymidylate biosynthesis in cancer therapy. Nat Rev Clin Oncol, 2014. 11(5): p. 282–98. [PubMed: 24732946]
- 8.
- Amstutz, U., S. Farese, S. Aebi, and C.R. Largiader, Dihydropyrimidine dehydrogenase gene variation and severe 5-fluorouracil toxicity: a haplotype assessment. Pharmacogenomics, 2009. 10(6): p. 931–44. [PubMed: 19530960]
- 9.
- Deenen, M.J., D. Meulendijks, A. Cats, M.K. Sechterberger, et al., Upfront Genotyping of DPYD*2A to Individualize Fluoropyrimidine Therapy: A Safety and Cost Analysis. J Clin Oncol, 2016. 34(3): p. 227–34. [PubMed: 26573078]
- 10.
- Boige, V., M. Vincent, P. Alexandre, S. Tejpar, et al., DPYD Genotyping to Predict Adverse Events Following Treatment With Fluorouracil-Based Adjuvant Chemotherapy in Patients With Stage III Colon Cancer: A Secondary Analysis of the PETACC-8 Randomized Clinical Trial. JAMA Oncol, 2016. 2(5): p. 655–662. [PubMed: 26794347]
- 11.
- Raida, M., W. Schwabe, P. Hausler, A.B. Van Kuilenburg, et al., Prevalence of a common point mutation in the dihydropyrimidine dehydrogenase (DPD) gene within the 5'-splice donor site of intron 14 in patients with severe 5-fluorouracil (5-FU)- related toxicity compared with controls. Clin Cancer Res, 2001. 7(9): p. 2832–9. [PubMed: 11555601]
- 12.
- Del Re, M., A. Michelucci, A. Di Leo, M. Cantore, et al., Discovery of novel mutations in the dihydropyrimidine dehydrogenase gene associated with toxicity of fluoropyrimidines and viewpoint on preemptive pharmacogenetic screening in patients. EPMA J, 2015. 6(1): p. 17. [PMC free article: PMC4556010] [PubMed: 26330892]
- 13.
- Lee, A.M., Q. Shi, E. Pavey, S.R. Alberts, et al., DPYD variants as predictors of 5-fluorouracil toxicity in adjuvant colon cancer treatment (NCCTG N0147). J Natl Cancer Inst, 2014. 106(12). [PMC free article: PMC4271081] [PubMed: 25381393]
- 14.
- Gentile, G., A. Botticelli, L. Lionetto, F. Mazzuca, et al., Genotype-phenotype correlations in 5-fluorouracil metabolism: a candidate DPYD haplotype to improve toxicity prediction. Pharmacogenomics J, 2016. 16(4): p. 320–5. [PubMed: 26216193]
- 15.
- Henricks, L.M., C.A. Lunenburg, D. Meulendijks, H. Gelderblom, et al., Translating DPYD genotype into DPD phenotype: using the DPYD gene activity score. Pharmacogenomics, 2015. 16(11): p. 1277–86. [PubMed: 26265346]
- 16.
- Toffoli, G., L. Giodini, A. Buonadonna, M. Berretta, et al., Clinical validity of a DPYD-based pharmacogenetic test to predict severe toxicity to fluoropyrimidines. Int J Cancer, 2015. 137(12): p. 2971–80. [PubMed: 26099996]
- 17.
- Yu, G., G.F. Li, and J.S. Markowitz, Atomoxetine: A Review of Its Pharmacokinetics and Pharmacogenomics Relative to Drug Disposition. J Child Adolesc Psychopharmacol, 2016. 26(4): p. 314–26. [PMC free article: PMC4876529] [PubMed: 26859445]
- 18.
- Drug Trials Snapshots: VISTOGARD. 2020 20 August 2020; Available from: https://web
.archive.org /web/20221126234744/https://www .fda.gov /drugs/drug-approvals-and-databases /drug-trials-snapshots-vistogard - 19.
- Ma, W.W., M.W. Saif, B.F. El-Rayes, M.G. Fakih, et al., Emergency use of uridine triacetate for the prevention and treatment of life-threatening 5-fluorouracil and capecitabine toxicity. Cancer, 2017. 123(2): p. 345–356. [PMC free article: PMC5248610] [PubMed: 27622829]
- 20.
- Baldeo, C., P. Vishnu, K. Mody, and P.M. Kasi, Uridine triacetate for severe 5-fluorouracil toxicity in a patient with thymidylate synthase gene variation: Potential pharmacogenomic implications. SAGE Open Med Case Rep, 2018. 6: p. 2050313X18786405. [PMC free article: PMC6041857] [PubMed: 30013790]
- 21.
- Velez-Velez, L.M., C.L. Hughes, and P.M. Kasi, Clinical Value of Pharmacogenomic Testing in a Patient Receiving FOLFIRINOX for Pancreatic Adenocarcinoma. Front Pharmacol, 2018. 9: p. 1309. [PMC free article: PMC6249237] [PubMed: 30498448]
- 22.
- Al-Sanna'a, N.A., A.B. Van Kuilenburg, T.M. Atrak, M.A. Abdul-Jabbar, et al., Dihydropyrimidine dehydrogenase deficiency presenting at birth. J Inherit Metab Dis, 2005. 28(5): p. 793–6. [PubMed: 16151913]
- 23.
- Van Kuilenburg, A.B., P. Vreken, N.G. Abeling, H.D. Bakker, et al., Genotype and phenotype in patients with dihydropyrimidine dehydrogenase deficiency. Hum Genet, 1999. 104(1): p. 1–9. [PubMed: 10071185]
- 24.
- Offer, S.M., C.C. Fossum, N.J. Wegner, A.J. Stuflesser, et al., Comparative functional analysis of DPYD variants of potential clinical relevance to dihydropyrimidine dehydrogenase activity. Cancer Res, 2014. 74(9): p. 2545–54. [PMC free article: PMC4012613] [PubMed: 24648345]
- 25.
- McLeod, H.L., E.S. Collie-Duguid, P. Vreken, M.R. Johnson, et al., Nomenclature for human DPYD alleles. Pharmacogenetics, 1998. 8(6): p. 455–9. [PubMed: 9918128]
- 26.
- Deenen, M.J., J. Tol, A.M. Burylo, V.D. Doodeman, et al., Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clin Cancer Res, 2011. 17(10): p. 3455–68. [PubMed: 21498394]
- 27.
- Van Kuilenburg, A.B., P. Vreken, N.G. Abeling, H.D. Bakker, et al., Genotype and phenotype in patients with dihydropyrimidine dehydrogenase deficiency. Human genetics, 1999. 104(1): p. 1–9. [PubMed: 10071185]
- 28.
- Saif, M.W., H. Ezzeldin, K. Vance, S. Sellers, et al., DPYD*2A mutation: the most common mutation associated with DPD deficiency. Cancer Chemother Pharmacol, 2007. 60(4): p. 503–7. [PubMed: 17165084]
- 29.
- Morel, A., M. Boisdron-Celle, L. Fey, P. Soulie, et al., Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Mol Cancer Ther, 2006. 5(11): p. 2895–904. [PubMed: 17121937]
- 30.
- Gonzalez, F.J. and P. Fernandez-Salguero, Diagnostic analysis, clinical importance and molecular basis of dihydropyrimidine dehydrogenase deficiency. Trends Pharmacol Sci, 1995. 16(10): p. 325–7. [PubMed: 7491709]
- 31.
- Lee, A., H. Ezzeldin, J. Fourie, and R. Diasio, Dihydropyrimidine dehydrogenase deficiency: impact of pharmacogenetics on 5-fluorouracil therapy. Clin Adv Hematol Oncol, 2004. 2(8): p. 527–32. [PubMed: 16163233]
- 32.
- Mattison, L.K., J. Fourie, R.A. Desmond, A. Modak, et al., Increased prevalence of dihydropyrimidine dehydrogenase deficiency in African-Americans compared with Caucasians. Clin Cancer Res, 2006. 12(18): p. 5491–5. [PubMed: 17000684]
- 33.
- Henricks, L.M., C. Lunenburg, F.M. de Man, D. Meulendijks, et al., DPYD genotype-guided dose individualisation of fluoropyrimidine therapy in patients with cancer: a prospective safety analysis. Lancet Oncol, 2018. 19(11): p. 1459–1467. [PubMed: 30348537]
- 34.
- Elraiyah, T., C.R. Jerde, S. Shrestha, R. Wu, et al., Novel Deleterious Dihydropyrimidine Dehydrogenase Variants May Contribute to 5-Fluorouracil Sensitivity in an East African Population. Clin Pharmacol Ther, 2017. 101(3): p. 382–390. [PMC free article: PMC5309195] [PubMed: 27727460]
- 35.
- Shin, J.G., H.S. Cheong, J.Y. Kim, L.H. Kim, et al., Screening of dihydropyrimidine dehydrogenase genetic variants by direct sequencing in different ethnic groups. J Korean Med Sci, 2013. 28(8): p. 1129–33. [PMC free article: PMC3744698] [PubMed: 23960437]
- 36.
- Cunha-Junior, G.F., L. Bastos-Rodrigues, P.G. Azevedo, M.A. Bicalho, et al., Prevalence of the DPYD variant (Y186C) in Brazilian individuals of African ancestry. Cancer Chemother Pharmacol, 2019. 84(6): p. 1359–1363. [PubMed: 31641844]
- 37.
- Ben Fredj, R., E. Gross, L. Chouchen, F. B'Chir, et al., Mutational spectrum of dihydropyrimidine dehydrogenase gene (DPYD) in the Tunisian population. C R Biol, 2007. 330(10): p. 764–9. [PubMed: 17905396]
- 38.
- Hamdy, S.I., M. Hiratsuka, K. Narahara, M. El-Enany, et al., Allele and genotype frequencies of polymorphic cytochromes P450 (CYP2C9, CYP2C19, CYP2E1) and dihydropyrimidine dehydrogenase (DPYD) in the Egyptian population. Br J Clin Pharmacol, 2002. 53(6): p. 596–603. [PMC free article: PMC1874334] [PubMed: 12047484]
- 39.
- Gonzalez-Covarrubias, V., M. Morales-Franco, O.F. Cruz-Correa, A. Martinez-Hernandez, et al., Variation in Actionable Pharmacogenetic Markers in Natives and Mestizos From Mexico. Front Pharmacol, 2019. 10: p. 1169. [PMC free article: PMC6796793] [PubMed: 31649539]
- 40.
- Wen, Y.F., K.A. Culhane-Pera, B. Thyagarajan, J.R. Bishop, et al., Potential Clinical Relevance of Differences in Allele Frequencies Found within Very Important Pharmacogenes between Hmong and East Asian Populations. Pharmacotherapy, 2020. 40(2): p. 142–152. [PubMed: 31884695]
- 41.
- Hariprakash, J.M., S.K. Vellarikkal, P. Keechilat, A. Verma, et al., Pharmacogenetic landscape of DPYD variants in south Asian populations by integration of genome-scale data. Pharmacogenomics, 2018. 19(3): p. 227–241. [PubMed: 29239269]
- 42.
- Thomas, F., I. Hennebelle, C. Delmas, I. Lochon, et al., Genotyping of a family with a novel deleterious DPYD mutation supports the pretherapeutic screening of DPD deficiency with dihydrouracil/uracil ratio. Clin Pharmacol Ther, 2016. 99(2): p. 235–42. [PubMed: 26265035]
- 43.
- Fluorouracil and fluorouracil related substances (capecitabine, tegafur and flucytosine) containing medicinal products. 7 July 2020; Available from: https://www
.ema.europa .eu/en/medicines/human /referrals/fluorouracil-fluorouracil-related-substances-capecitabine-tegafur-flucytosine-containing-medicinal. - 44.
- Toren, W., D. Ansari, B. Andersson, L. Spelt, et al., Thymidylate synthase: a predictive biomarker in resected colorectal liver metastases receiving 5-FU treatment. Future Oncol, 2018. 14(4): p. 343–351. [PubMed: 29318904]
- 45.
- Pellicer, M., X. Garcia-Gonzalez, M.I. Garcia, L. Robles, et al., Identification of new SNPs associated with severe toxicity to capecitabine. Pharmacol Res, 2017. 120: p. 133–137. [PubMed: 28347776]
- 46.
- Abbasian, M.H., N. Ansarinejad, B. Abbasi, M. Iravani, et al., The Role of Dihydropyrimidine Dehydrogenase and Thymidylate Synthase Polymorphisms in Fluoropyrimidine-Based Cancer Chemotherapy in an Iranian Population. Avicenna J Med Biotechnol, 2020. 12(3): p. 157–164. [PMC free article: PMC7368113] [PubMed: 32695278]
- 47.
- Chao, Y.L. and C.K. Anders, TYMS Gene Polymorphisms in Breast Cancer Patients Receiving 5-Fluorouracil-Based Chemotherapy. Clin Breast Cancer, 2018. 18(3): p. e301–e304. [PMC free article: PMC6759830] [PubMed: 28899623]
- 48.
- Castro-Rojas, C.A., A.R. Esparza-Mota, F. Hernandez-Cabrera, V.J. Romero-Diaz, et al., Thymidylate synthase gene variants as predictors of clinical response and toxicity to fluoropyrimidine-based chemotherapy for colorectal cancer. Drug Metab Pers Ther, 2017. 32(4): p. 209–218. [PubMed: 29257755]
- 49.
- Hamzic, S., D. Kummer, T.K. Froehlich, M. Joerger, et al., Evaluating the role of ENOSF1 and TYMS variants as predictors in fluoropyrimidine-related toxicities: An IPD meta-analysis. Pharmacol Res, 2020. 152: p. 104594. [PubMed: 31838077]
- 50.
- Wilks, A.B. and M.W. Saif, First Case of Foot Drop Associated with Capecitabine in a Patient with Thymidylate Synthase Polymorphism. Cureus, 2017. 9(1): p. e995. [PMC free article: PMC5325748] [PubMed: 28280649]
- 51.
- Marsh, S., D.J. Van Booven, and H.L. McLeod. Very Important Pharmacogene: TYMS. 2019 10 October 2019 September 2020]; Available from: https://www
.pharmgkb.org/vip/PA166165418. - 52.
- Saif, M.W., Capecitabine-induced cerebellar toxicity and TYMS pharmacogenetics. Anticancer Drugs, 2019. 30(4): p. 431–434. [PubMed: 30875351]
- 53.
- Mandola, M.V., J. Stoehlmacher, S. Muller-Weeks, G. Cesarone, et al., A novel single nucleotide polymorphism within the 5' tandem repeat polymorphism of the thymidylate synthase gene abolishes USF-1 binding and alters transcriptional activity. Cancer Res, 2003. 63(11): p. 2898–904. [PubMed: 12782596]
- 54.
- CPIC. Genes-Drugs. 2020 17 Sept 2020 18 Sept 2020]; Available from: https://www
.clinpgx.org/cpic/pairs. - 55.
- Lunenburg, C., L.M. Henricks, E. Dreussi, F.P. Peters, et al., Standard fluoropyrimidine dosages in chemoradiation therapy result in an increased risk of severe toxicity in DPYD variant allele carriers. Eur J Cancer, 2018. 104: p. 210–218. [PubMed: 30361102]
- 56.
- Kasi, P.M., T. Koep, E. Schnettler, F. Shahjehan, et al., Feasibility of Integrating Panel-Based Pharmacogenomics Testing for Chemotherapy and Supportive Care in Patients With Colorectal Cancer. Technol Cancer Res Treat, 2019. 18: p. 1533033819873924. [PMC free article: PMC6753511] [PubMed: 31533552]
- 57.
- De Falco, V., M.I. Natalicchio, S. Napolitano, N. Coppola, et al., A case report of a severe fluoropyrimidine-related toxicity due to an uncommon DPYD variant. Medicine (Baltimore), 2019. 98(21): p. e15759. [PMC free article: PMC6571425] [PubMed: 31124962]
- 58.
- Henricks, L.M., L.N. van Merendonk, D. Meulendijks, M.J. Deenen, et al., Effectiveness and safety of reduced-dose fluoropyrimidine therapy in patients carrying the DPYD*2A variant: A matched pair analysis. Int J Cancer, 2019. 144(9): p. 2347–2354. [PubMed: 30485432]
- 59.
- Martens, F.K., D.W. Huntjens, T. Rigter, M. Bartels, et al., DPD Testing Before Treatment With Fluoropyrimidines in the Amsterdam UMCs: An Evaluation of Current Pharmacogenetic Practice. Front Pharmacol, 2019. 10: p. 1609. [PMC free article: PMC6997151] [PubMed: 32047438]
- 60.
- Stavraka, C., A. Pouptsis, L. Okonta, K. DeSouza, et al., Clinical implementation of pre-treatment DPYD genotyping in capecitabine-treated metastatic breast cancer patients. Breast Cancer Res Treat, 2019. 175(2): p. 511–517. [PMC free article: PMC6533219] [PubMed: 30746637]
- 61.
- Henricks, L.M., C. Lunenburg, F.M. de Man, D. Meulendijks, et al., A cost analysis of upfront DPYD genotype-guided dose individualisation in fluoropyrimidine-based anticancer therapy. Eur J Cancer, 2019. 107: p. 60–67. [PubMed: 30544060]
- 62.
- Madi, A., D. Fisher, T.S. Maughan, J.P. Colley, et al., Pharmacogenetic analyses of 2183 patients with advanced colorectal cancer; potential role for common dihydropyrimidine dehydrogenase variants in toxicity to chemotherapy. Eur J Cancer, 2018. 102: p. 31–39. [PubMed: 30114658]
- 63.
- Iachetta, F., C. Bonelli, A. Romagnani, R. Zamponi, et al., The clinical relevance of multiple DPYD polymorphisms on patients candidate for fluoropyrimidine based-chemotherapy. An Italian case-control study. Br J Cancer, 2019. 120(8): p. 834–839. [PMC free article: PMC6474277] [PubMed: 30858516]
- 64.
- Garcia-Gonzalez, X., B. Kaczmarczyk, J. Abarca-Zabalia, F. Thomas, et al., New DPYD variants causing DPD deficiency in patients treated with fluoropyrimidine. Cancer Chemother Pharmacol, 2020. 86(1): p. 45–54. [PubMed: 32529295]
- 65.
- Hishinuma, E., Y. Narita, S. Saito, M. Maekawa, et al., Functional Characterization of 21 Allelic Variants of Dihydropyrimidine Dehydrogenase Identified in 1070 Japanese Individuals. Drug Metab Dispos, 2018. 46(8): p. 1083–1090. [PubMed: 29769267]
- 66.
- van Staveren, M.C., H.J. Guchelaar, A.B. van Kuilenburg, H. Gelderblom, et al., Evaluation of predictive tests for screening for dihydropyrimidine dehydrogenase deficiency. Pharmacogenomics J, 2013. 13(5): p. 389–95. [PubMed: 23856855]
- 67.
- Meulendijks, D., A. Cats, J.H. Beijnen, and J.H. Schellens, Improving safety of fluoropyrimidine chemotherapy by individualizing treatment based on dihydropyrimidine dehydrogenase activity - Ready for clinical practice? Cancer Treat Rev, 2016. 50: p. 23–34. [PubMed: 27589829]
- 68.
- Caudle, K.E., C.F. Thorn, T.E. Klein, J.J. Swen, et al., Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing. Clin Pharmacol Ther, 2013. 94(6): p. 640–5. [PMC free article: PMC3831181] [PubMed: 23988873]
- 69.
- Kalman, L.V., J. Agundez, M.L. Appell, J.L. Black, et al., Pharmacogenetic allele nomenclature: International workgroup recommendations for test result reporting. Clin Pharmacol Ther, 2016. 99(2): p. 172–85. [PMC free article: PMC4724253] [PubMed: 26479518]
Footnotes
- 1
The FDA labels specific drug formulations. We have substituted the generic names for any drug labels in this excerpt. The FDA may not have labeled all formulations containing the generic drug. Certain terms, genes and genetic variants may be corrected in accordance to nomenclature standards, where necessary. We have given the full name of abbreviations, shown in square brackets, where necessary.
- 2
Note: the official gene symbol is DYPD, DPD is an alternate gene symbol.
- Review Capecitabine Therapy and DPYD Genotype.[MINI Medical Genetics Summarie...]Review Capecitabine Therapy and DPYD Genotype.Dean L, Kane M. MINI Medical Genetics Summaries. 2012
- Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.[Eur J Hum Genet. 2020]Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.Lunenburg CATC, van der Wouden CH, Nijenhuis M, Crommentuijn-van Rhenen MH, de Boer-Veger NJ, Buunk AM, Houwink EJF, Mulder H, Rongen GA, van Schaik RHN, et al. Eur J Hum Genet. 2020 Apr; 28(4):508-517. Epub 2019 Nov 19.
- DPYD genotype-guided dose individualisation of fluoropyrimidine therapy in patients with cancer: a prospective safety analysis.[Lancet Oncol. 2018]DPYD genotype-guided dose individualisation of fluoropyrimidine therapy in patients with cancer: a prospective safety analysis.Henricks LM, Lunenburg CATC, de Man FM, Meulendijks D, Frederix GWJ, Kienhuis E, Creemers GJ, Baars A, Dezentjé VO, Imholz ALT, et al. Lancet Oncol. 2018 Nov; 19(11):1459-1467. Epub 2018 Oct 19.
- Benefit of uridine triacetate (Vistogard) in rescuing severe 5-fluorouracil toxicity in patients with dihydropyrimidine dehydrogenase (DPYD) deficiency.[Cancer Chemother Pharmacol. 2016]Benefit of uridine triacetate (Vistogard) in rescuing severe 5-fluorouracil toxicity in patients with dihydropyrimidine dehydrogenase (DPYD) deficiency.Saif MW, Diasio RB. Cancer Chemother Pharmacol. 2016 Jul; 78(1):151-6. Epub 2016 Jun 8.
- Review [Dihydropyrimidine déhydrogenase (DPD) deficiency screening and securing of fluoropyrimidine-based chemotherapies: Update and recommendations of the French GPCO-Unicancer and RNPGx networks].[Bull Cancer. 2018]Review [Dihydropyrimidine déhydrogenase (DPD) deficiency screening and securing of fluoropyrimidine-based chemotherapies: Update and recommendations of the French GPCO-Unicancer and RNPGx networks].Loriot MA, Ciccolini J, Thomas F, Barin-Le-Guellec C, Royer B, Milano G, Picard N, Becquemont L, Verstuyft C, Narjoz C, et al. Bull Cancer. 2018 Apr; 105(4):397-407. Epub 2018 Feb 24.
- Fluorouracil Therapy and DPYD Genotype - Medical Genetics SummariesFluorouracil Therapy and DPYD Genotype - Medical Genetics Summaries
Your browsing activity is empty.
Activity recording is turned off.
See more...
2.