Table 4Position penalties for SSO nucleotide mismatches

5'10987654321123456789103'
0.220.220.340.340.700.700.800.800.800.800.800.800.800.800.700.700.340.340.220.22
ProbeTTTCTTCACATCCGTGTCCC
DNA templateTTTCTCCACATCCGTGTCCC

Match score calculation for SSO probes.
A 20-mer SSO anneals to a mismatched DNA. Both probe and template are shown in the sense orientation. The substitution of T with C leads to the probe-template mismatch T-G with a penalty of 0.42 (refer to Table 2).
This position has a 70% influence on the overall probe reactivity.
The overall probe score is 1 − (0.7 × 0.42) = 0.71.

From: Chapter 11, The Major Histocompatibility Complex Database, dbMHC

Cover of The NCBI Handbook
The NCBI Handbook [Internet].
McEntyre J, Ostell J, editors.
Bethesda (MD): National Center for Biotechnology Information (US); 2002-.

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.