BioProject

Primary RNAseq data from carefully sorted immunocyte populations, sequenced using ImmGen's SOP for 'ultra-low-input' population RNAseq (typically 500 to 1,000 cells) performed by Smartseq2. Overall design: This Superseries is an umbrella for all datasets generated by ImmGen labs using a joint low-input population RNAseq protocol. The actual datasets that use this joint protocol are listed below. In practice, cell samples collected across ImmGen participating labs (or collaborating labs for OpenSource projects) are prepared to very high purity (2 rounds or more of cell sorting) using the ImmGen SOP (immgen.org; see below). After direct lysis, samples are frozen and shipped to the ImmGen Core team for common library construction and sequencing using ImmGen's standard RNA-seq (SmartSeq2) pipeline at the Broad Institute’s Technology Lab. More...

Primary RNAseq data from carefully sorted immunocyte populations, sequenced using ImmGen's SOP for 'ultra-low-input' population RNAseq (typically 500 to 1,000 cells) performed by Smartseq2. Overall design: This Superseries is an umbrella for all datasets generated by ImmGen labs using a joint low-input population RNAseq protocol. The actual datasets that use this joint protocol are listed below. In practice, cell samples collected across ImmGen participating labs (or collaborating labs for OpenSource projects) are prepared to very high purity (2 rounds or more of cell sorting) using the ImmGen SOP (immgen.org; see below). After direct lysis, samples are frozen and shipped to the ImmGen Core team for common library construction and sequencing using ImmGen's standard RNA-seq (SmartSeq2) pipeline at the Broad Institute’s Technology Lab. After the final sort of 500 to 1,000 cells directly into 5ul lysis buffer (TCL Buffer (Qiagen) with 1% 2- Mercaptoethanol), Smart-seq2 libraries were prepared as previously described (Picelli et al., 2013; Picelli et al., 2014) with slight modifications. Briefly, total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was then selected using an anchored oligo(dT) primer (5'AAGCAGTGGTATCAACGCAGAGTACT30VN-3') and converted to cDNA via reverse transcription. First strand cDNA was subjected to limited PCR amplification followed by Tn5 transposon based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina). Samples were then PCR amplified for 18 cycles using barcoded primers such that each sample carries a specific combination of eight base Illumina P5 and P7 barcodes and pooled together prior to Smart sequencing. Smart-seq paired-end sequencing was performed on an Illumina NextSeq500 using 2 x 25bp reads with no further trimming. Less...