Sign in to NCBI

Display Settings:

Format

Send to:

Choose Destination
Accession: PRJNA518128 ID: 518128

Adapter-ligated sequencing libraries of total cellular Amphidinium carterae RNA

MiSeq sequencing libraries of total cellular RNA harvested from Amphidinium carterae CCMP1314, ligated to a custom GCUGAUGGCGAUGAGCACUGGGUUGCAA RNA adapter, and converted into double-stranded cDNA using a Maxima H Minus double stranded cDNA synthesis kit. More...
AccessionPRJNA518128
Data TypeRaw sequence reads
ScopeMultispecies
SubmissionRegistration date: 31-Jan-2019
University of Cambridge
RelevanceEnvironmental
Project Data:
Resource NameNumber
of Links
Sequence data
SRA Experiments2
Other datasets
BioSample4
SRA Data Details
ParameterValue
Data volume, Gbases4
Data volume, Mbytes2561

Supplemental Content

Related information

  • BioSample
    All related BioSamples
  • SRA
    All related SRA Experiments

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
You are here: NCBI
Support Center