BioProject

We report high-affinity ssDNA aptamers as biomarkers and antagonist against the amyloid-β peptide. More...

We report high-affinity ssDNA aptamers as biomarkers and antagonist against the amyloid-β peptide. We generated three novel aptamers sequences from the pool of aptamers through SELEX process, and the affinity and sensitivity were evaluated using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomer, dimer, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitute the complex structure of the aptamer-amyloid-β peptide. Further, the changes in the secondary structure induced by aptamers may help to remove the peptide through the blood-brain barrier. This study provides a framework for the application of aptamers against amyloid-β peptide as a biomarker and antagonist. Overall design: generationa and modeling of aptamers against amyloid-β peptide and its mechanism of action. Please note that the raw data corresponding for the aptamers were submitted which is required for the study (rest of the readings/files are discarded) and since the resulting raw data contains only 4 lines with 23 or 64 bp reads, they are included as GEO sample supplementary files. Less...