Skip Nav

An organized view of the transcripome



Library:9771 (dbEST ID)

Gm-c1082

Library Description

Organism:Glycine max
Cultivar:Minsoy x Noir RI progeny
Tissue:Roots of bulked Minsoy x Noir RI progeny
Vector:pBluescript II SK+
Vector type:plasmid
Cloning site 1:EcoRI
Cloning site 2:XhoI
Lab host:DH10B

The mRNA was isolated from roots of bulked Minsoy x Noir RI progeny that are phenotypically susceptible to flooding damage. The plants were flooded (submerged) for 24 hours prior to harvest. Dr. Tara VanToai generously provided the isolated mRNA. The roots were flash- frozen in liquid nitrogen. Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An 'anchor' nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA, ligated to EcoRI adapters and subsequently phosphorylated. The cDNA was then precipitated and redissolved in sterile, RNase-, DNase-free water. The XhoI site within the first- strand synthesis primer was then restricted by digestion with XhoI from Promega (40U/ul); all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500bp cutoff, using Sephacryl S-500 High Resolution (Pharmacia Biotech) in a 2-mm diameter column and a bed volume of approximately 1ml. The column eluent was precipitated, redissolved, and ligated into Stratagene's pBluescript II XR Predigested vector (pBluescript II SK(+) vector that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene). This library was constucted in the laboratory of Dr. Paul Keim and Dr. Virginia H. Coryell at Northern Arizona University.

Source: Shoemaker R/Public Soybean EST Project, Washington University School of Medicine

Gene Content Analysis

2,973 ESTs from this library were grouped into 1,390 UniGene entries (putative genes) [UniGene build #42, 26-Feb-2012]. EST counts for each entry may be used to calculate an approximate expression level in transcripts per million (TPM).

ESTs TPM   UniGene Entry
237 79717 Gma.39228 Uncharacterized LOC100785417.
118 39691 Gma.53290 Uncharacterized LOC100811611.
71 23882 Gma.35282 Expansin-like B1-like.
57 19173 Gma.31969 Uncharacterized LOC100790544.
53 17827 Gma.4112 Miraculin-like.
50 16818 Gma.52375 Uncharacterized LOC100500518.
43 14464 Gma.28360 Uncharacterized LOC100527782.
34 11436 Gma.30760 PIP2,2.
28 9418 Gma.51588 Uncharacterized LOC100804125.
24 8073 Gma.53291 Uncharacterized LOC100779901.
24 8073 Gma.28357 Expansin-like B1-like.
23 7736 Gma.54635 Proline-rich protein.
18 6054 Gma.53292 Uncharacterized LOC100780432.
17 5718 Gma.7447 Probable aquaporin PIP-type 7a-like.
17 5718 Gma.13013 Uncharacterized LOC100797452.
16 5382 Gma.54695 Uncharacterized LOC100500124.
14 4709 Gma.4186 Uncharacterized LOC100306683.
14 4709 Gma.2019 Lipoxygenase.
14 4709 Gma.15996 Transcribed locus, strongly similar to XP_003533862.1 PREDICTED: repetitive proline-rich cell wall protein 1-like isoform 1 [Glycine max].
13 4373 Gma.4152 Miraculin-like.
13 4373 Gma.30906 Hydroxyproline-rich glycoprotein.
13 4373 Gma.14024 Uncharacterized LOC100306193.
12 4036 Gma.56378 Uncharacterized LOC100305819.
12 4036 Gma.54863 Alcohol dehydrogenase 1-like.
12 4036 Gma.4195 Agglutinin-1-like.
12 4036 Gma.4168 Miraculin-like.
12 4036 Gma.4122 Uncharacterized LOC100500648.
12 4036 Gma.30877 Cysteine proteinase inhibitor 1-like.
11 3700 Gma.30087 Expansin-like B1-like.
10 3364 Gma.28361 Probable rhamnogalacturonate lyase B-like.
10 3364 Gma.28351 Polygalacturonase inhibitor 2-like.
9 3027 Gma.62494 Miraculin-like.
9 3027 Gma.4815 Elongation factor-1A.
9 3027 Gma.32001 Isoflavone reductase homolog A622-like.
8 2691 Gma.54662 Stem-specific protein TSJT1-like.
8 2691 Gma.30991 Hydroxyproline-rich glycoprotein.
8 2691 Gma.30853 Peroxidase 73-like.
8 2691 Gma.21520 Polygalacturonase inhibitor 2-like.
7 2355 Gma.59238 Estradiol 17-beta-dehydrogenase 12-like.
7 2355 Gma.57582 Expansin-like B1-like.
7 2355 Gma.54872 Fructose-bisphosphate aldolase, cytoplasmic isozyme-like.
7 2355 Gma.3926 Stress-induced protein SAM22.
7 2355 Gma.35399 Polygalacturonase inhibitor 2-like.
7 2355 Gma.3013 Uncharacterized LOC100500345.
7 2355 Gma.28356 Uncharacterized LOC100500599.
7 2355 Gma.17053 Glyceraldehyde-3-dehydrogenase C subunit.
6 2018 Gma.5533 Pyruvate kinase, cytosolic isozyme-like.
6 2018 Gma.54921 Uncharacterized LOC100500033.
6 2018 Gma.4176 Homeobox-leucine zipper protein REVOLUTA-like.
6 2018 Gma.30928 Glyceraldehyde-3-phosphate dehydrogenase.
6 2018 Gma.27360 MYB transcription factor MYB75.
6 2018 Gma.11052 Cyanate hydratase.
5 1682 Gma.60978 Alcohol dehydrogenase 1-like.
5 1682 Gma.593 MYB transcription factor MYB176.
5 1682 Gma.54796 Universal stress protein A-like protein-like.
5 1682 Gma.54626 B2 protein-like.
5 1682 Gma.52390 Uncharacterized LOC100527769.
5 1682 Gma.4819 Enolase-like.
5 1682 Gma.4624 Organ-specific protein S2-like.
5 1682 Gma.32059 Epoxide hydrolase.
5 1682 Gma.31362 Uncharacterized LOC100796671.
5 1682 Gma.31122 Ubiquitin.
5 1682 Gma.30870 Sucrose synthase.
5 1682 Gma.29826 Pyruvate kinase.
5 1682 Gma.26983 Transcribed locus.
5 1682 Gma.24477 Stem-specific protein TSJT1-like.
5 1682 Gma.18247 Uncharacterized LOC100305513.
5 1682 Gma.18241 Ripening related protein.
5 1682 Gma.17855 HMG-1 like protein gene.
5 1682 Gma.17525 Translationally controlled tumor-like protein.
5 1682 Gma.10675 Chalcone synthase.
4 1345 Gma.8565 Probable xyloglucan endotransglucosylase/hydrolase protein 23-like.
4 1345 Gma.6889 Uncharacterized LOC100305594.
4 1345 Gma.58673 Uncharacterized LOC100820064.
4 1345 Gma.57508 Uncharacterized LOC547601.
4 1345 Gma.54946 Uncharacterized LOC100526873.
4 1345 Gma.53293 Uncharacterized LOC100783288.
4 1345 Gma.52757 Uncharacterized LOC100306421.
4 1345 Gma.3346 Uncharacterized LOC100306492.
4 1345 Gma.31587 Peptidyl-prolyl cis-trans isomerase-like 2-like.
4 1345 Gma.30864 Sucrose synthase-like.
4 1345 Gma.30783 Uncharacterized LOC100500229.
4 1345 Gma.3066 Uncharacterized LOC100527371.
4 1345 Gma.30013 Probable aquaporin PIP-type 7a-like.
4 1345 Gma.29711 Salt stress root protein RS1-like.
4 1345 Gma.28362 Glutaredoxin-C9-like.
4 1345 Gma.28355 Uncharacterized LOC100793388.
4 1345 Gma.26985 TIR-NBS disease resistance-like protein.
4 1345 Gma.26984 Protease inhibitor-like.
4 1345 Gma.26976 Putative glutamine amidotransferase-like protein RP404-like.
4 1345 Gma.25214 Uncharacterized LOC100776723.
4 1345 Gma.24865 Subtilisin-like protease-like.
4 1345 Gma.20895 Isoliquiritigenin 2'-O-methyltransferase-like.
4 1345 Gma.17942 Uncharacterized LOC100527721.
4 1345 Gma.16708 Histone H3.3-like.
4 1345 Gma.12973 Nodulin-26.
3 1009 Gma.9511 Uncharacterized LOC100306246.
3 1009 Gma.6433 Acyl-CoA oxidase.
3 1009 Gma.6263 Phosphoglycerate kinase, cytosolic-like.
3 1009 Gma.62493 Probable cysteine desulfurase-like.

1 2 3 4 5 6 7 8 9 Next> Last>>

Source: NCBI UniGene

EST Sequences

3,182 EST sequences from this library have been submitted to the public sequence database as of 26-Feb-2012.

Source: NCBI GenBank

Click the button to save sequences to a file (FASTA format)

Keywords

  • root
  • unknown developmental stage
  • water stress

Source: NCBI Clone Registry



National Center for Biotechnology Information
U.S. National Library of Medicine
8600 Rockville Pike, Bethesda, MD 20894