skip to main content
Enter a query string   or TI number 
   
Search result: found 16,515,909 items Your request is: PROJECT_NAME = "TCGA"
Save result of search as .tar .gz file. Only 40,000 traces will be saved (see Searching Tips if you wish to save all data)  
Retrieve   as by    item(s) per Page  / 3,303,182 
 

Info for TI=1885304175

1885304175
BI6e4075ca163c4075f1c08965ac38ff45.F.3.T0
BI
HOMO SAPIENS
MEDICAL RESEQUENCING
PCR
NEW
GENOMIC
9606
GGCAGTAACGAGGTCTCCTG
CGAGGAGGAAGAGGTCAGTC
683
C141
BIGDYEV3.0
TERMINATOR
40
863
EGFR
PHRED-0.040406.A
TCGA
NC_000007.12
55205225
55205907
3730
BI6e4075ca163c4075f1c08965ac38ff45
FORWARD
ZTR
55205907
55205225
BI37977369F0CFC4537633F2131FD7D58D
Tissue Site:  Blood
Pathological Status:  Non-Malignant
TCGA website:  http://cancergenome.nih.gov
Clinical Diagnosis:  Glioblastoma
Histological Diagnosis:  No Histology Available
0
863
Aug 3 2007 8:26PM
active

Info for TI=1885304177

1885304177
BIb042022a909abad31901240a4fd82cde.F.3.T0
BI
HOMO SAPIENS
MEDICAL RESEQUENCING
PCR
NEW
GENOMIC
9606
ATTTGCTGATGTGAGCAGGG
GCAGCAGAGCAAGGAGCC
410
C141
BIGDYEV3.0
TERMINATOR
40
976
ULK1
PHRED-0.040406.A
TCGA
NC_000012.10
130960550
130960959
3730
BIb042022a909abad31901240a4fd82cde
FORWARD
ZTR
130960959
130960550
BI76F6D4F71133EA8A2ACC8887B76247A9
Tissue Site:  Blood
Pathological Status:  Non-Malignant
TCGA website:  http://cancergenome.nih.gov
Clinical Diagnosis:  Glioblastoma
Histological Diagnosis:  No Histology Available
0
976
Aug 3 2007 8:27PM
active

Info for TI=1885304178

1885304178
BI6aa1567356d9b1719b6174fab71333b5.F.3.T0
BI
HOMO SAPIENS
MEDICAL RESEQUENCING
PCR
NEW
GENOMIC
9606
CAGAGGGTACAGTATGTAATCTGGC
AATAGAAGCAGGTCCCTTGCC
570
C141
BIGDYEV3.0
TERMINATOR
40
786
SERPING1
PHRED-0.040406.A
TCGA
NC_000011.8
57138227
57138796
3730
BI6aa1567356d9b1719b6174fab71333b5
FORWARD
ZTR
57138796
57138227
BIC05702E74A32ABAED6611F1040E4858F
Tissue Site:  Blood
Pathological Status:  Non-Malignant
TCGA website:  http://cancergenome.nih.gov
Clinical Diagnosis:  Glioblastoma
Histological Diagnosis:  No Histology Available
0
786
Aug 3 2007 8:27PM
active

Info for TI=1885304179

1885304179
BIf01bc55b8c7140b1ccb0e579077b89ac.F.3.T0
BI
HOMO SAPIENS
MEDICAL RESEQUENCING
PCR
NEW
GENOMIC
9606
TGCTCCTGTTCAGTTGAATTT
TGAATTTAGTTCAAAGTTTTTACCTGT
274
C142
BIGDYEV3.0
TERMINATOR
40
764
COL3A1
PHRED-0.040406.A
TCGA
NC_000002.10
189567381
189567654
3730
BIf01bc55b8c7140b1ccb0e579077b89ac
FORWARD
ZTR
189567654
189567381
BI3F37D4C9C6D0704315FD983FAE9ECBE0
Tissue Site:  Brain, NOS
Pathological Status:  Malignant
TCGA website:  http://cancergenome.nih.gov
Clinical Diagnosis:  Glioblastoma
Histological Diagnosis:  Glioblastoma Multiforme
0
764
Aug 3 2007 8:27PM
active

Info for TI=1885304185

1885304185
BIbf5805111f2c723d01f22746cd66c817.R.3.T0
BI
HOMO SAPIENS
MEDICAL RESEQUENCING
PCR
NEW
GENOMIC
9606
GAATATGTAACATCCTCAACAGCG
AGAAACCACAATGGATGGGG
611
C141
BIGDYEV3.0
TERMINATOR
25
827
CBL
PHRED-0.040406.A
TCGA
NC_000011.8
118647445
118648055
3730
BIbf5805111f2c723d01f22746cd66c817
REVERSE
ZTR
118648055
118647445
BID3795B006CCEC294295C04CE59F16254
Tissue Site:  Blood
Pathological Status:  Non-Malignant
TCGA website:  http://cancergenome.nih.gov
Clinical Diagnosis:  Glioblastoma
Histological Diagnosis:  No Histology Available
0
827
Aug 3 2007 8:27PM
active