5T7B: Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine Modified Mrttr Guide Rna Complex

PDB ID: 5T7BDownload
MMDB ID: 145678
PDB Deposition Date: 2016/9/2
Updated in MMDB: 2016/12
Experimental Method:
x-ray diffraction
Resolution: 2.53  Å
Source Organism:
Mus musculus
Similar Structures:
Biological Unit for 5T7B: dimeric; determined by author and by software (PISA)
Molecular Components in 5T7B
Label Count Molecule
Protein (1 molecule)
1
Protein Argonaute-2(Gene symbol: AGO2)
Molecule annotation
Nucleotide(1 molecule)
1
RNA (Uvp)uauagagcaagaacacuguu
Molecule annotation
Chemicals (2 molecules)
1
2
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.