5J05: Diy G-quadruplexes: Solution Structure Of D(gggtttgggttttgggaggg) In Sodium

PDB ID: 5J05Download
MMDB ID: 149463
PDB Deposition Date: 2016/3/27
Updated in MMDB: 2017/04
Experimental Method:
solution nmr
Source Organism:
Biological Unit for 5J05: monomeric; determined by software (PISA)
Molecular Components in 5J05
Label Count Molecule
Nucleotide(1 molecule)
1
DNA (5'- D(*gp*gp*gp*tp*tp*tp*gp*gp*gp*tp*tp*tp*tp*gp*gp*gp*ap*gp*gp*g)-3')
Molecule annotation
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.