5J05: DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium

PDB ID: 5J05Download
MMDB ID: 149463
PDB Deposition Date: 2016/3/27
Updated in MMDB: 2019/10
Experimental Method:
solution nmr
Source Organism:
Molecular Components in 5J05
Label Count Molecule
Nucleotide(1 molecule)
1
DNA (5'-d(*gp*gp*gp*tp*tp*tp*gp*gp*gp*tp*tp*tp*tp*gp*gp*gp*ap*gp*gp*g)-3')
Molecule annotation
* Click molecule labels to explore molecular sequence information.
Citing MMDB
Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. " MMDB and VAST+: tracking structural similarities between macromolecular complexes. Nucleic Acids Res. 2014 Jan; 42(Database issue):D297-303