5E3O: Crystal Structure Of Fis Bound To 27bp Dna F32 (aaatttggaggaattttctccaaattt)

PDB ID: 5E3ODownload
MMDB ID: 137273
PDB Deposition Date: 2015/10/3
Updated in MMDB: 2016/03
Experimental Method:
x-ray diffraction
Resolution: 2.78  Å
Source Organism:
Escherichia coli K-12
Similar Structures:
Biological Unit for 5E3O: tetrameric; determined by author and by software (PISA)
Molecular Components in 5E3O
Label Count Molecule
Proteins (2 molecules)
2
DNA-binding Protein FIS(Gene symbol: fis)
Molecule annotation
Nucleotides(2 molecules)
1
DNA (27-mer)
Molecule annotation
1
DNA (27-mer)
Molecule annotation
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.