5E3O: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

PDB ID: 5E3ODownload
MMDB ID: 137273
PDB Deposition Date: 2015/10/3
Updated in MMDB: 2024/03
Experimental Method:
x-ray diffraction
Resolution: 2.78  Å
Source Organism:
Escherichia coli K-12▼
Similar Structures:
Molecular Components in 5E3O
Label Count Molecule
Proteins (2 molecules)
2
DNA-binding Protein FIS
Molecule annotation
Nucleotides(2 molecules)
1
DNA (27-mer)
Molecule annotation
1
DNA (27-mer)
Molecule annotation
* Click molecule labels to explore molecular sequence information.
Citing MMDB
Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. " MMDB and VAST+: tracking structural similarities between macromolecular complexes. Nucleic Acids Res. 2014 Jan; 42(Database issue):D297-303