5DTD: Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

PDB ID: 5DTDDownload
MMDB ID: 137268
PDB Deposition Date: 2015/9/17
Updated in MMDB: 2023/09
Experimental Method:
x-ray diffraction
Resolution: 2.642  Å
Source Organism:
Escherichia coli K-12
Similar Structures:
Molecular Components in 5DTD
Label Count Molecule
Proteins (2 molecules)
2
DNA-binding Protein FIS
Molecule annotation
Nucleotides(2 molecules)
1
DNA (27-mer)
Molecule annotation
1
DNA (27-mer)
Molecule annotation
* Click molecule labels to explore molecular sequence information.

Citing MMDB