2M6W: Solution Nmr Structure Of The D(ggggttggggttttggggaagggg) Quadruplex In Sodium Conditions

Citation:
No citation available for this structure.
PDB ID: 2M6WDownload
MMDB ID: 121621
PDB Deposition Date: 2013/4/19
Updated in MMDB: 2014/10
Experimental Method:
solution nmr
Source Organism:
Biological Unit for 2M6W: monomeric; determined by author
Molecular Components in 2M6W
Label Count Molecule
Nucleotide(1 molecule)
1
DNA (5'- D(*gp*gp*gp*gp*tp*tp*gp*gp*gp*gp*tp*tp*tp*tp*gp*gp*gp*gp*ap*ap*gp*gp* Gp*g)-3')
Molecule annotation
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.