1TLR: Solution Structure Of Tetraloop Receptor Rna, Nmr, 20 Structures

PDB ID: 1TLRDownload
MMDB ID: 51524
PDB Deposition Date: 1997/9/11
Updated in MMDB: 2007/10
Experimental Method:
solution nmr
Source Organism:
Molecular Components in 1TLR
Label Count Molecule
Nucleotide(1 molecule)
1
RNA Tetraloop Receptor (5'- R(ggccuaagacuucgguuauggcc)-3')
Molecule annotation
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.