1SAX: Three-Dimensional Structure Of S.Aureus Methicillin-Resistance Regulating Transcriptional Repressor Meci In Complex With 25-Bp Ds- Dna

PDB ID: 1SAXDownload
MMDB ID: 51305
PDB Deposition Date: 2004/2/9
Updated in MMDB: 2012/11
Experimental Method:
x-ray diffraction
Resolution: 2.8  Å
Source Organism:
Staphylococcus aureus subsp. aureus N315
Similar Structures:
Biological Unit for 1SAX: tetrameric; determined by author
Molecular Components in 1SAX
Label Count Molecule
Proteins (2 molecules)
2
Methicillin Resistance Regulatory Protein Meci
Molecule annotation
Nucleotides(2 molecules)
1
5'-d(gctccgatattacagttgtaatttt)-3'
Molecule annotation
1
5'-d(caaaattacaactgtaatatcggag)-3'
Molecule annotation
Chemical (1 molecule)
1
1
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.