1KX4: X-Ray Structure Of The Nucleosome Core Particle, Ncp146b, At 2.6 A Resolution

PDB ID: 1KX4Download
MMDB ID: 103929
PDB Deposition Date: 2002/1/31
Updated in MMDB: 2012/10
Experimental Method:
x-ray diffraction
Resolution: 2.6  Å
Source Organism:
Homo sapiens
Similar Structures:
Biological Unit for 1KX4: decameric; determined by author
Molecular Components in 1KX4
Label Count Molecule
Proteins (8 molecules)
2
Histone H3
Molecule annotation
2
Histone H4
Molecule annotation
2
Histone H2a.1(Gene symbol: h2afx.L)
Molecule annotation
2
Histone H2b.2(Gene symbol: hist1h2bj.S)
Molecule annotation
Nucleotide(1 molecule)
2
DNA (5'(atctccaaatatcccttgcggatcgtagaaaaagtgtgtcaaactgcgctatcaa Agggaaacttcaactgaattcagttgaagtttccctttgatagcgcagtttgacacact Ttttctacgatccgcaagggatatttggagat)3')
Molecule annotation
Chemicals (10 molecules)
1
6
2
4
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.